Highly invasive human MM A2058 cells, moderately invasive human MM A375 cells, normal epidermal melanocyte HEMa-LP cells, 293 and B16/F10 were obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China), where they were characterized by mycoplasma detection, DNA-fingerprinting, isozyme detection and cell vitality detection. A2058, A375, 293 and B16/F10 cells were cultured in Dulbecco's modified Eagle's medium (DMEM; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) at 37°C in a humidified atmosphere of 95% air and 5% CO₂. HEMa-LP cells were cultured in Medium 254 (Invitrogen; Thermo Fisher Scientific, Inc.) suplemented with human melanocyte growth supplement (Hyclone; GE Healthcare Life Sciences) at 37°C in a humidified atmosphere of 95% air and 5% CO₂.

pGMLV-lncRNA-ATB negative control (NC), pGMLV-lncRNA-ATB short hairpin (sh)RNA, miRNA (miR)-590-5p NC, miR-590-5p mimics and miR-590-5p inhibitors were purchased from GenePharma Co. Ltd. (Shanghai, China). The sequence for miR-590-5p was GAGCUUAUUCAUAAAAUGCAG; miR-NC was GUCCAGUGAAUUCCCAG; and miR-590-5p inhibitors was GACGUAAAAUACUUAUUCGAG. The lncRNA-ATB overexpressing plasmid was constructed by Shanghai GeneChem Co., Ltd. (Shanghai, China) using pCDNA3.1. An empty vector was used as the control (Shanghai GeneChem Co., Ltd.). When the cell confluence of A375 and A2058 cells reached 50-60%, oligonucleotide transfections were performed using Lipofectamine^® 2000 (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Oligonucleotides (50 nmol) were mixed with 5 µl Lipofectamine^® 2000 in 500 µl medium. The transfection solutions were added to each well containing 500 µl medium. Following transfection, cell samples were collected at 48 h for further analyses.

For lncRNA-ATB quantification, total RNA was extracted from the cells or tissues using TRI reagent (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany), according to the manufacturer's protocol. RNA samples were reverse transcribed into cDNA using RT regeants (Takara Bio, Inc., Otsu, Japan) with lncRNA specific primers, and β-actin was used as internal loading controls. RT was performed at 45°C for 60 min and 70°C for 10 min. SYBR Mix (Takara Bio, Inc.) was used to detect and quantify lncRNA-ATB and β-actin expression. For miR-590-5p quantification, total miRNA was extracted from the cells or tissues using the miRNeasy RNA isolation kit (Qiagen, Inc., Valencia, CA, USA), according to the manufacturer's protocol. Total miRNA samples (1 µl; 1 µg/µl) were reverse transcribed into cDNA using the miScript RT kit (Qiagen GmbH, Hilden, Germany) with miR-590-5p specific primers, and universal small nuclear U6 RNA was used as an internal loading control. An Applied Biosystems™ SYBR™ Green dye miRNA RT-qPCR kit (Thermo Fisher Scientific, Inc.) was used to detect and quantify miR-590-5p and U6 expression. Data were analyzed with 7500 software v.2.0.1 (Applied Biosystems; Thermo Fisher Scientific, Inc.), with the automatic Cq setting for adapting baseline and threshold for Cq determination (18). Each sample was examined in triplicate. The primer sequences used in the present study are listed in Table I. RT-qPCR assays were performed under the following thermocycling conditions: 95°C for 5 min, followed by 45 cycles of 95°C for 15 sec, 60°C for 30 sec and 72°C for 30 sec.

Cells were washed in PBS three times prior to the proteins being extracted. Cells were lysed using radioimmunoprecipitation assay buffer (JingCai Technologies, Inc., Xi'an, China) and the protein concentration was determined using the bicinchoninic acid method. Each protein sample (30 µg) was denatured in SDS sample buffer and separated via 10% SDS-PAGE. Separated proteins were transferred to polyvinylidene fluoride membranes (EMD Millipore, Billerica, MA, USA), blocked with 5% bovine serum albumin (BSA; Beyotime Institute of Biotechnology, Haimen, China) for 2 h at room temperature, and incubated overnight with primary antibodies at 4°C. Blotting was performed with primary antibodies against Yes associated protein 1 (YAP1; 1:300; cat. no. 14074; Cell Signaling Technology, Inc., Danvers, MA, USA). Goat anti-rabbit immunoglobulin horseradish peroxidase-linked F(ab)2 fragments (1:5,000; cat. no. TA130071; OriGene Technologies, Inc., Beijing, China) were used as secondary antibodies for 2 h at room temperature. β-actin (1:4,000; cat. no. ab8226; Abcam, Cambridge, UK) was used as a loading control. Blots were then washed three times (10 min/wash) in TBS-Tween-20 and developed using an enhanced chemiluminescence system (JingCai Technologies, Inc.). ImageJ (National Institutes of Health, Bethesda, MD, USA) was used to analyze the gray values of each blot.

A2058 cells transfected with lncRNA-ATB NC or lncRNA-ATB shRNA 24 h previously, and A375 cells transfected with empty vector or lncRNA-ATB overexpressing vector 24 h previously, were seeded in a 96-well culture plate at 2,000 cells/well. Each group was established in nine wells. CCK-8 reagents (cat. no. 40203ES60; Yeasen Biological Technology, Inc., Shanghai, China) were added into each well at 24, 48, 72, 96 and 120 h post-seeding, and each group was cultured for a further 50 min at 37°C in a humidified atmosphere of 95% air and 5% CO₂. The optical density values was measured at 490 nm using a microplate reader.

MM cells in a 6-well culture plate were harvested by trypsinization, and washed three times with PBS. For cellular apoptosis analysis, cells were suspended in 500 µl binding buffer at a density of 2×10⁶ cells/ml, and incubated with Annexin V-fluoroscein isothiocyanate and propidium iodide (PI; BD Biosciences, San Jose, CA, USA) for 15 min in the dark at room temperature. For cell cycle analysis, PI was added into A2058 cells tranfected with lncRNA-ATB NC or lncRNA-ATB, and A375 cells transfected with empty vector or lncRNA-ATB overexpressing vector, and incubated for 20 min in the dark at room temperature. Cellular apoptosis and the cell cycle were analyzed using a flow cytometer and Kaluza analysis software version 2.0 (both Beckman Coulter, Inc., Brea, CA, USA).

Cell migration and invasion capacity were measured in vitro using Transwell migration assays (EMD Millipore). A2058 cells transfected with lncRNA-ATB NC or lncRNA-ATB, and A375 cells transfected with empty vector or lncRNA-ATB overexpressing vector were suspended in DMEM with 10 g/l BSA at a density of 5×10⁵ cells/ml. Cell suspensions (200 µl) were seeded in the upper chamber with membrane coated with (for the Transwell invasion assay) or without (for the migration assay) Matrigel (BD Biosciences). To attract the cells, 600 µl DMEM with 10% serum was added to the bottom chamber. When the cells had been allowed to migrate for 24 h or to invade for 48 h, the penetrated cells on the filters were fixed in dried methanol for 1 min and stained with 4 g/l crystal violet for 10 min at room temperature. The numbers of migrated or invasive cells were determined from five random fields using a light microscope (Olympus Corporation, Tokyo, Japan) at ×10 magnification.

All animals were treated in accordance with the Guide for the Care and Use of Laboratory Animals, 1996, by the National Research Council (US) Institute for Laboratory Animal Research (19). Animal experiments were approved by and carried out according to the guidelines of the Ethics Committee of the First Affiliated Hospital of Xi'an Jiaotong University (Xi'an, China).

The full length lncRNA-ATB sequence or NC sequence was amplified by PCR kit (Takara Bio, Inc.) using a T7-containing primer. The following primer sequences were used: lncRNA-ATB forward, 5′-TCCCTGACTCCTCTATGGCATCTGTGG-3′; lncRNA-ATB reverse, 5′-CCTTTGCTTCCTCTTTTCTCATCTACTC-3′. The thermocycling conditions were as stated above. The DNA fragments were cloned into pcDNA3.1. The restriction enzyme XhoI was used to linearize the plasmids. T7 RNA polymerase (Takara Bio, Inc.) and Biotin RNA Labeling Mix (Roche Diagnostics, Indianapolis, IN, USA) was used to make biotin-labeled RNAs that were reverse transcribed. The products were treated with RNase-free DNase I (Roche Diagnostics) and purified with an RNeasy Mini kit (Qiagen, Inc.), and subsequently mixed with RNA extract from A2058 cells and incubated at room temperature for 1 h. The pull-down complexes were analyzed by RT-qPCR as previously stated following subsequent washes.

All mice were housed and maintained under specific pathogen-free conditions at 18-22°C, with 20% humidity, a 12-h light and 12-h dark cycle, with feeding ad libitum. All experiments were approved by the Animal Care and Use Committee of Xi'an Jiaotong University and performed in accordance with institutional guidelines. For the tumorigenesis assays, xenograft tumors were generated via subcutaneous injection of A2058 cells (5×10⁶), including A2058 lncRNA-ATB NC and A2058 lncRNA-ATB shRNA, into the hind limbs of 18-20-g 4-6-week-old Balb/C female athymic nude mice (nu/nu; Animal Center of Xi'an Jiaotong University, Xi'an, China; total number, 10 mice; n=5 mice/group). Tumor size was measured using a vernier caliper. Tumor volume was determined by the following formula: 0.5× A× B², where A represents the diameter of the base of the tumor and B represents the corresponding perpendicular value. After 35 days, the mice were sacrificed and the tumors were collected and weighed. For the lung colonization assay, B16/F10 cells (5×10⁶), which included lncRNA-ATB NC-luciferase and lncRNA-ATB shRNA-luciferase were intravenously injected into 18-20-g 6-week-old female C57/B6 mice (total number, 10 mice; n=5 mice/group). Lung colonization was measured using Xenogen IVIS Kinetic imaging systems (PerkinElmer, Inc., Waltham, MA, USA) on days 0, 7 and 14 post-injection.

The putative binding sites of miR-590-5p for lncRNA-ATB were predicted using RNA hybrid (20) and miRDB (http://www.mirdb.org/). Two hundreds and ninety-three cells were seeded in a 96-well plate at 70% confluence. The lncRNA-ATB was cloned into pMir-Report (Ambion; Thermo Fisher Scientific, Inc.), yielding pMir-Report-lncRNA-ATB. Mutations were introduced in potential miR-590-5p binding sites using the QuikChange site-directed mutagenesis kit (Stratagene; Agilent Technologies, Inc., Santa Clara, CA, USA). miR-590-5p NC or mimics were transfected into 293 cells with 30 ng wild-type (WT) or mutant (Mut) 3′-untranslated region (UTR) of lncRNA-ATB using Lipofectamine^® 2000, as previously stated. Cells were collected 48 h post-transfection, and luciferase assays were performed using a Photinus pyralis-Renilla reniformis dual luciferase reporter assay system, according to the manufacturer's protocol (Promega Corporation, Madison, WI, USA). The luciferase activity of each lysate was normalized to Renilla luciferase activity.

Differentially expressed lncRNAs were identified from the GEO database GSE3189 with false discovery rate (FDR) <0.01 and |logFC| >1 using the R package (21). The raw P-value was corrected using the Benjamini and Hochberg method (22) to circumvent the multi-test bias. A fold-change value >2 or <0.25 and FDR <0.01 were selected as cutoff criteria for differentially expressed lncRNAs. Statistical analysis was performed using SPSS statistical software (version 21.0; IBM Corp., Armonk, NY, USA). The differences in characteristics between two groups were examined by the Student's t-test. The differences in characteristics between three groups were examined by analysis of variance, and the least significant difference test was applied to detect the differences between each pair of groups. The correlation between miR-590-5p expression and YAP1 expression was analyzed by Pearson correlation analysis. All P-values were determined from two-sided tests, and P<0.05 was considered to indicate a statistically significant difference. All experiments were repeated three times and the data are presented as the mean ± standard deviation from three independent experiments.

To elucidate the critical lncRNAs involved in the carcinogenesis and progression of MM, comparative lncRNA profiling was performed in 45 MM, 18 benign skin nevus cell (BN), and seven normal skin tissue specimens from the GEO dataset GSE3189 (23). Vectorgram analysis further identified that lncRNA-ATB was upregulated in MM specimens compared with BN (Fig. 1A and Table II). The volcano plot illustrates that the lncRNA-ATB expression level was >4-fold increased between cases and controls (P<0.001; Fig. 1B). The significant upregulation of lncRNA-ATB was further confirmed using RT-qPCR in the human epidermal melanocyte cell line HEMa-LP and in MM cell lines (Fig. 1C).

To investigate the functional role of lncRNA-ATB in MM cells, gain- and loss-of function experiments were performed by transfecting an shRNA, shLncRNA-ATB, into the highly invasive MM cell line A2058 to knock down lncRNA-ATB expression (Fig. 1D; P<0.05). An lncRNA-ATB overexpressing plasmid was also transfected into the moderately invasive MM cell line A375 to stably overexpress lncRNA-ATB. CCK-8 assays indicated that the proliferation of A2058 cells transfected with shLncRNA-ATB was inhibited compared with that in the control (Fig. 2A). However, the proliferation of A375 cells transfected with the lncRNA-ATB overexpressing plasmid was enhanced compared with that in the control (Fig. 2B). Cellular apoptosis assays demonstrated that the percentage of early apoptotic cells increased in A2058 cells transfected with shLncRNA-ATB. Whereas, the percentage of early apoptotic cells decreased in A375 cells transfected with the lncRNA-ATB overexpressing plasmid (Fig. 2C and D).

Cell cycle assays (Fig. 3) demonstrated that A2058 cells transfected with shLncRNA-ATB displayed a significant increase in the percentage of cells in the G1 phase and a decrease in the percentage of cells in the S phase (Fig. 3A and C). By contrast, the percentage of cells in the G1 phase decreased and the percentage of cells in the S phase increased in A375 cells transfected with the lncRNA-ATB overexpressing plasmid compared with that in the control (Fig. 3B and D).

The present study further investigated the effects of lncRNA-ATB on the cell migration and invasion of MM cells using Transwell assays (Fig. 4). The cell migration assays indicated a significant decrease in the number of migratory cells among A2058 cells transfected with shLncRNA-ATB compared with the control (Fig. 4A and C). By contrast, ectopic expression of lncRNA-ATB significantly increased the number of migratory A375 cells compared with the normal control (Fig. 4A and D). As expected, cell invasion assays also confirmed a decrease in the number of invasive cells among A2058 cells transfected with shLncRNA-ATB compared with the control (Fig. 4B and C). Ectopic expression of lncRNA-ATB significantly enhanced the invasive ability of A375 cells compared with the control (Fig. 4B and D).

The effect of lncRNA-ATB on the tumorigenic ability of MM cells was detected in vivo. shLncRNA-ATB and luciferase were transfected into A2058 cells and tumorigenesis assays were performed in nude mice. Cells (5×10⁶) were injected into the flanks of the nude mice. Tumor sizes were measured using the Xenogen IVIS Kinetic imaging system and Vernier calipers every 7 days. After 35 days, the mice were sacrificed, and the tumors were collected and weighed. It was identified that shLncRNA-ATB had a significant tumor growth-inhibitory effect, causing significant reductions in tumor size (Fig. 5A and B) and weight (Fig. 5C) in the shLncRNA-ATB group compared with the control group. B16/F10 melanoma cells transfected with shLncRNA-ATB or controls were injected intravenously into C57/B6 mice, and lung colonization was assessed using the Xenogen IVIS200 System. It was identified that lung metastasis was inhibited in mice injected with B16/F10 cells transfected with shLn-cRNA-ATB, in comparison with the A2058 cells transfected with a control shRNA (Fig. 5D). Taken together, these results indicated that lncRNA-ATB was upregulated in MM cells, and that knockdown of lncRNA-ATB was able to repress cell proliferation, cell migration, cell invasion and tumor growth in vitro and in vivo.

To examine the potential interaction between YAP1 and its targeting miRNA, miR-590-5p was identified as a potential targeting miRNA that has putative binding sites for lncRNA-ATB (Fig. 6A; data from RNA hybrid and miRDB), by searching in online bioinformatics databases. RT-qPCR assays revealed that miR-590-5p mimics and inhibitors were able to effectively upregulate and downregulate miR-590-5p expression, respectively, in MM cells (Fig. 6B; P<0.01). The biotin-labeled pulldown assay indicated that lncRNA-ATB was able to directly pull down miR-590-5p, which suggested that lncRNA-ATB may directly and specifically sponge miR-590-5p (Fig. 6C). Accordingly, miR-590-5p expression was significantly increased in A2058 cells transfected with shLncRNA-ATB, and significantly downregulated in A375 cells transfected with the lncRNA-ATB overexpressing plasmid (Fig. 6D; P<0.05). In addition, a dual-luciferase reporter assay was performed to verify whether lncRNA-ATB was the functional target of miR-590-5p. It was observed that miR-590-5p was able to reduce the relative luciferase activity of WT-LncRNA-ATB. Conversely, co-transfection of 293 cells with Mut-LncRNA-ATB and miR-590-5p resulted in a non-significant alteration in the relative luciferase activity (Fig. 6E). The RT-qPCR results showed that ectopic expression of miR-590-5p in A2058 cells inhibited lncRNA-ATB expression, while lncRNA-ATB expression was upregulated in A375 cells transfected with miR-590-5p inhibitors (Fig. 6F). These results demonstrated that miR-590-5p was also able to directly bind to lncRNA-ATB at specific recognition sites. A previous study reported miR-590-5p may function as a tumor suppressing miRNA in A375 cells (24). In addition, it may inhibit the cell migration and invasion of A375 by directly targeting YAP1. Thus, the present study investigated the effects of lncRNA-ATB on the YAP1 protein expression level. The western blotting results demonstrated that the expression of YAP1 protein was significantly downregulated in A2058 cells transfected with shLncRNA-ATB. By contrast, ectopic expression of lncRNA-ATB in A375 cells resulted in increased YAP1 protein expression levels (Fig. 6G and H).