ORI (procured from Hao-Xuan Bio-Tech Co., Ltd., Xi'an, China) was dissolved in DMSO at the concentration of 10 mmol/l and stored at −20°C. For the in vivo experiments, an ORI suspension was prepared with a 0.4% carboxymethylcellulose sodium (CMC-Na) solution. All primary antibodies used in this study were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). The inhibitors of p53 [pifithrin-β hydrobromide (PFT) cat. no. S2929] and p38 (SB203580; cat. no. S1076) were purchased from Shanghai Selleck Chemicals Co., Ltd. (Shanghai, China). All the cell lines used (HCT116, SW620, SW480 LoVo and FHC) were obtained from the American Type Culture Collection (ATCC, Manassas, VA, USA). The cells were cultured in Dulbecco's modified Eagle's medium with 10% fetal bovine serum, 100 U/ml of penicillin and 100 μg/ml of streptomycin solution at 37°C under a 5% CO₂ environment.

The recombinant adenoviruses for BMP7 and p53 were constructed using the AdEasy system (22), tagged with green fluorescence protein (GFP) and designated as AdBMP7 or Adp53. The GFP-expressing recombinant adenovirus was used only as a vector control (AdGFP). Samples were collected at 24 or 48 h following transfection.

Cell viability and proliferation were determined using a cell counting kit-8 (CCK-8). Briefly, the SW620 cells were seeded onto 96-well plates at 3×10³ cells/well and treated with various concentrations of ORI solutions (0, 5, 10, 15, 20 and 25 μM), corresponding reagents or DMSO. After 24, 48 or 72 h, 10 μl of CCK-8 were added to each well followed by incubation at 37°C for 4 h. The optical absorbance was determined at 450 nm using a microplate reader (ELx800; BioTek Instruments, Inc., Winooski, VT, USA). Each assay was conducted in triplicate.

The SW620 cells were seeded into 6-well plates and treated for 48 h as per protocol (0, 10, 15 and 20 μM). For analyzing cellular apoptosis, the cells were collected and washed with PBS (4°C) and incubated with Annexin V EGFP and propidium iodide (PI; Keygenbio, Nanjing, China). The cells were then sorted following fluorescence activation. For cell cycle analysis, the cells were collected and washed with PBS (4°C), fixed with chilled (4°C) 70% ethanol, washed with 50 and 30% ethanol, and PBS. The cells were then stained with 1 ml of PI (20 mg/ml) containing RNase (1 mg/ml) for 30 min and analyzed by flow cytometry (BD Influx; BD Biosciences, Franklin Lakes, NJ, USA). Each assay was carried out in triplicate.

Sub-confluent SW620 cells were plated in T25 flasks and treated with various concentrations of ORI (0, 5, 10, 15, 20 and 25 μM) or corresponding reagents. Total RNA was extracted from the cells using TRIzol reagent (Invitrogen/Thermo Fisher Scientific, Waltham, MA, USA) and subjected to reverse transcription to generate cDNA using a PrimeScript RT Reagent kit (Takara, Kosatsu, Japan). The cDNA was then used as a template for the qPCR assay with 2X SYBR-Green qPCR Master Mix (Bimake, Houston, TX, USA). The PCR thermocycling conditions were as follows: 95°C for 1 min for pre-denaturation, then 30 cycles of 92°C for 2 min for denaturation, 55°C for 45 sec for annealing and 72°C for 45 sec for elongation, finally 72°C for 5 min for re-elongation. The primer sequences used in this study were as follows: (5′–3′): GAPDH forward, CAACGAATTTGGCTACAGCA and reverse, AGGGGAGATTCAGTGTGGTG; p53 forward, GTCGGTGGGTTGGTAGTTTCTA and reverse, AAAAAGAAATTGACCCTGAGCA; BMP7 forward, GGCAGGACTGGATCATCG and reverse, AAGTGGACCAGCGTCTGC. RT-qPCR results were analyzed by 2^−ΔΔCq method described by Livak and Schmittgen (23). Each assay was carried out in triplicate.

Sub-confluent SW620 cells were seeded in 6-well plates and then treated with various concentrations of ORI (10, 15 and 20 μM) or corresponding regents. At the scheduled time point (24 or 48 h), cells were lysed with 300 μl lysis buffer (10% SD; Glycerinum; Tris-Hcl, 1 M, pH 6.8; protease inhibitor cocktail, EDTA-Free, 100X in DMSO; phosphatase inhibitor cocktail, 2 tubes, 100X; H₂O) in each well, and the lysate was boiled for 10 min. The protein concentration was determined using the BCA Protein Assay kit, and a total of 40 μg protein was loaded per lane and subjected to electrophoresis by 10% SDS-PAGE separation and transferred onto polyvinylidene fluoride membranes. The membranes were then blotted with corresponding primary antibodies against GAPDH (sc-32233-R, 1:3,000), Bad (sc-8044-M, 1:3,000), Bcl-2 (sc-7382-M, 1:3,000), p53 (sc-55476-M, 1:3,000), phospho-p53 (sc-17105-G, 1:3,000), BMP7 (sc-9305-G, 1:3,000), Smad1/5/8 (sc-6031-R, 1:3,000), phospho-Smad1/5/8 (sc-12353-G, 1:3,000), p38 (sc-535-R, 1:3,000) and phospho-p38 (sc-7973-M, 1:3,000) for 12 h at 4°C. The membranes were then immunoblotted with HRP-conjugated secondary antibodies (goat anti-rabbit lgG, SA00001-2, 1:3,000; goat anti-mouse lgG, SA00001-1, 1:3,000; rabbit anti-goat IgG, SA00004-4, 1:3,000) successively, all antibodies used in this study were purchased from Santa Cruz Biotechnology, Inc.. The target proteins were developed with SuperSignal West Femto Substrate (#34095; Thermo Scientifc, Rockford, IL, USA). Each assay was done in triplicate.

The cells were seeded in 48-well plates and treated as per protocol (0, 10 and 20 μM). At the scheduled time point (48 h), the cells were fixed with methanol (4°C) for 15 min, washed with PBS (4°C), permeabilized with 0.5% Triton X-100, and then blocked with 5% BSA at room temperature for 1 h and incubated with the primary antibody for the protein-target (p53, sc-55476-M, 1:100; BMP7, sc-9305-G; 1:100; Santa Cruz Biotechnology, Inc.). The corresponding IgGs (negative control) were incubated with FITC-conjugated with corresponding secondary antibodies (goat anti-mouse lgG, SA00001-1, 1:100; rabbit anti-goat IgG, SA00004-4, 1:100; Santa Cruz Biotechnology, Inc.) for 30 min. Finally, the cells were stained with DAPI (1 μg/ml, Solarbio, Beijing, China). Images were recorded under an inverted microscope (Nikon ECLIPSE Ti-S; Nikon Corporation, Tokyo, Japan). Each assay was carried out in triplicate.

All animal experiments followed the guidelines of the Institutional Animal Care and Use Committee of Chongqing Medical University (Chongqing, China). Athymic nude mice (female, weighing 14–15 g, 4–6 weeks old, 5/group, 4 groups in total) were ordered and kept at the animal center of Chongqing Medical University (26–28°C, 40–60% relative humidity), and fed by the staff. The SW620 cells were cultured and treated with ORI and/or AdBMP7. The cells were then harvested, resuspended in PBS (4°C) and injected subcutaneously (1×10⁶/injection) into the right flanks of athymic nude mice. The mice were administered intragastrically with an ORI suspension (50 or 100 mg/kg) or the same volume of CMC-Na once daily for 3 weeks. After 3 weeks, all nude mice were sacrificed to retrieve all the tumor samples. The weights and diameters of the tumor samples were measured with digital calipers, and the volume of a tumor was calculated using the following formula: Tumor volume (cm³) = longer diameter × shorter diameter²/2. The samples were then fixed in 10% formalin and embedded in paraffin. Serial sections of the embedded samples were stained with hematoxylin and eosin (H&E) or immunohistochemical stains (All stains were made by School of Basic Medicine of Chongqing Medical University, Chongqing, China). Each experiment was carried out 3 times.

All data are presented as the means ± standard deviation (SD). The differences between groups were estimated by one-way analysis of variance followed by a Dunn-Bonferroni test for multiple comparisons and a value of P<0.05 was considered to indicate a statistically significant difference.

In this study, we tried to elucidate the possible molecular mechanisms behind the anticancer effects of ORI against colon cancer. The anti-proliferative activity of ORI against the SW620 cell line was time- and concentration-dependent and significantly higher than the other cell lines (Fig. 1A), which would justify the selection of the SW620 cells for use in the following experiments. The results of the flow cytometric assay revealed that ORI arrested the cells at predominately the G2 phase of the cell cycle (Fig. 1B). These results suggest that ORI inhibits the proliferation of colon cancer cells.

The pro-apoptotic effects of ORI against SW620 cells were also determined. The results of flow cytometric analysis revealed the concentration-dependent pro-apoptotic potential of ORI against the colon cancer cells (Fig. 2A). ORI also increased the expression levels of Bad, and decreased those of Bcl-2 (Fig. 2B). These data suggest that ORI may be a potent inducer of the apoptosis of colon cancer cells.

The role of p53 in mediating the anticancer effects of ORI was also investigated in colon cancer cells. The results of the RT-qPCR assay revealed that ORI significantly upregulated the expression of p53 (Fig. 3A). The results of cell immunofluorescence staining and western blot assay analysis also revealed that ORI increased the level of p53 and p-p53 in a time- and concentration-dependent manner (Fig. 3B and C). Thus, these results suggest that ORI exerts anticancer effects on colon cancer cells through the activation of the p53 signal.

The effects of p53 on the anti-proliferative activity of ORI were investigated in the colon cancer cells transfected with p53 recombinant adenoviruses or treated with a specific inhibitor (PFT, 3 μg/ml). The results of the CCK-8 assay indicated that PFT markedly attenuated the p53-induced enhancement of the anti-proliferative effects of ORI against the SW620 cells (Fig. 4A and B). The results of flow cytometric analysis revealed that the combination of ORI and p53 did not markedly affect the ORI-induced cell cycle arrest; however, the p53 specific inhibitor substantially attenuated the ORI-induced G2 phase arrest in the SW620 cells (Fig. 4C). Therefore, these data indicate that the anti-proliferative activity of ORI may be partially mediated by the activation of the p53 signal.

We have already established the mediatory role of p53 in the anti-proliferative effects of ORI against the SW620 cells. However, the molecular mechanisms behind these effects (ORI-induced activation of the p53 signal) remain unknown. According to our previous study, BMP7 mediated the anticancer activity of ORI against HCT116 cells (14). In this study, the potential role of ORI in upregulating BMP7 expression and the associations between BMP7 and p53 wre investigated in colon cancer cells. The results of RT-qPCR revealed that ORI upregulated the mRNA level of BMP7 in a concentration-dependent manner in the SW620 cells (Fig. 5A). The results of western blot analysis and cell immunofluorescence detection assays revealed that ORI notably increased the level of BMP7 in the SW620 cells (Fig. 5B and C). Furthermore, the results revealed that either the mRNA or protein expression of BMP7 was detectable in the colon cancer cell lines and FHC cells (normal colon epithelial cell line). Moreover, the endogenous expression of BMP7 was higher in the colon cancer cell lines than that in the FHC cells (Fig. 5D and E). All these results indicate that BMP7 may also be involved in the anticancer activity of ORI in SW620 cells.

The effects of BMP7 on the anticancer activity of ORI were analyzed in SW620 cells. The results of the CCK-8 assay revealed that exogenous BMP7 enhanced the anti-proliferative effects of ORI; however, the BMP7-specific antibody significantly decreased the anti-proliferative effects of ORI on the SW620 cells (Fig. 6A and B). In addition, the results of our in vivo experiments revealed that the weight and size of the tumors in the mice who received a combination of ORI and BMP7 were significantly smaller than those of the mice treated with ORI alone (Fig. 6C–E). The results of H&E-staining also revealed that BMP7 enhanced ORI-induced karyopyknosis. Thus, these data indicate that the anticancer effects of ORI may be partly mediated by the upregulation of BMP7 in SW620 cells.

BMP7 exerts its physiological function through the BMP/Smad pathway (canonical BMP/Smad pathway) or non-canonical BMP/Smad pathway (24). The ORI-induced upregulation of BMP7 may thus mediate the anticancer activity of ORI in colon cancer cells. Therefore, in this study, we hypothesized that ORI may affect the canonical or non-canonical BMP/Smad signaling pathway. The results of western blot analysis did not reveal any substantial effect of ORI on the levels of Smad1/5/8 or phosphorylated Smad1/5/8 in the SW620 cells; however, ORI markedly increased the level of phosphorylated p38 in the SW620 cells without any apparent effect on the level of total p38 (Fig. 7A). We also investigated the effects of p38 on the p53 signal in SW620 cells. We employed a p38 specific inhibitor (SB203580, 7 μg/ml) and found that the inhibition of p38 markedly attenuated the promoting effects of ORI on the levels of p53 and p-p53 (Fig. 7B). These data suggest that ORI exerts its anticancer effects through p38 to trigger the p53 signal in SW620 cells.

In this study, we found that ORI can upregulate BMP7 and the p53 signal in SW620 cells and activate p38, but cannot trigger the BMP/Smad signal in SW620 cells. Thus, we hypothesized that ORI may affect the activation of the p53 signal by activating p38. The results of western blot analysis indicated that BMP7 overexpression further increased the levels of p38 and p53 induced by ORI (Fig. 8A). However, the use of a specific antibody to BMP7 almost eliminated the promoting effects of ORI on the activation of p38 and p53 (Fig. 8B). These data suggest that BMP7 mediates the anticancer effects of ORI by activating p38 and p53 successively in SW620 cells.