The malignancy of glioblastoma (GB) is primarily due to the ability of glioma cancer stem cells (GSC) to disseminate into surrounding brain tissues, despite surgery and chemotherapy, and to form new tumoral masses. Members of the RGD-binding integrin family, which recognize the arginine-glycine-aspartic acid (RGD) sequence present in components of the extracellular matrix, and which serve a crucial function in the dissemination of GCS, are overexpressed in GB. Small-molecule integrin antagonists (SMIAs) designed to recognize RGD-integrins may therefore be an effective tool for decreasing GB infiltration and recurrence. In the present study,
The principal issue in the therapy of glioma is the recurrence, even following surgical debulking combined with radio- or chemotherapy, of newly formed solid masses in other distant areas of the brain. These recurrences are due to glioma cells that detach from the original tumor mass and disseminate in the brain parenchyma to establish new tumoral niches. The relatively poor advancement in glioma therapy in the last decades may be partly due to the lack of suitable
Since glioma recurrence primarily involves mechanisms associated with cell detachment and attachment (
Certain RGD-binding integrins, particularly αvβ3, αvβ5 and α5β1, are overexpressed in glioma cells compared with normal brain tissues. They have also been identified to be expressed by non-tumoral cell types present in the tumoral niche, such as proliferating vascular endothelial cells and pericytes (
These compounds have primarily been tested on glioma and other cancer cell lines grown in the presence of serum, and, although the function of integrins and periostin in gliomas has been well-characterized (
In an attempt to rectify this deficit in our knowledge, the functional effects elicited by SMIA-integrin binding in modulating the ECM-integrin interaction and the subsequent effects elicited by 1a-RGD on integrin-dependent signal transduction pathways in three human GSC lines grown in serum-free medium and plated on laminin coated dishes were investigated.
The results of the present study indicated that 1a-RGD decreases cell migration and induces cell detachment and caspase-dependent anoikis in detached GSC, thus highlighting the important potential of SMIA to decrease the malignant dissemination of GSC.
1a-RGD was synthesized as described previously (
Samples designated GSC3, GSC4 and GSC7 were isolated from tumor tissue in the Neurosurgery Department at the Institute for Research, Hospitalization and Care-University Hospital (IRCCS-AOU) San Martino-Cancer Research Institute (IST) (Genoa, Italy) following informed consent, according to European Union legislation on informed consent and The Declaration of Helsinki, from the patients and Institutional Ethical Committee (IRCCS San Martino-IST) approval. The donor patients were undergoing brain surgery for the first time. Patients had never received previous radio- or chemotherapy and their tumors were classified by the pathologists as glioblastoma (GB) grade IV (World Health Organization classification). Clinicopathological characteristics are presented in
Primary cell cultures were established as described previously (
All experiments involving animals were performed at IRCCS-AOU San Martino-IST in compliance with the guidelines approved by the Italian Ministry of Health and the Committee for Animal Well-Being in Cancer Research.
Normal human astrocytes (NHA) were purchased from Thermo Fisher Scientific, Inc. and grown in Astrocyte Medium (Gibco; Thermo Fisher Scientific, Inc.) in the presence of 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.), according to the manufacturer’s protocol. NHA were used for experiments not beyond the fifth
GSC cultures were seeded on Matrigel-coated glass coverslips and maintained for 2 weeks in DMEM/Ham’s F12 supplemented with 2 mM L-glutamine, 50 IU/ml penicillin/50
GSC and their differentiated counterparts plated onto laminin-coated glass coverslips were fixed with 4% paraformaldehyde, permeabilized with PBS/0.1% Triton X-100, and stained with the following primary antibodies: Mouse monoclonal anti-nestin (1:1,000; cat. no. MAB1259; Novus Biologicals, Ltd., Cambridge, UK), rabbit anti-microtubule-associated protein 2 (MAP2; 1:1,000; cat. no. PA5-17646; Chemicon International; Thermo Fisher Scientific, Inc.), rabbit anti-glial fibrillary acidic protein (GFAP; 1:10,000; cat. no. Z0334; Dako; Agilent Technologies, Inc., Santa Clara, CA, USA) and rabbit anti-sex-determining region Y box 2 (SOX2; 1:500; cat. no. AB5603; EMD Millipore, Billerica, MA, USA). Immunocomplexes were detected with secondary fluorescent antibodies DyLight 488-conjugated goat anti-mouse immunoglobulin G (IgG) (cat. no. 111-545-003) and DyLight 594-conjugated goat anti-rabbit IgG (cat. no. 111-585-003) (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA, USA). Cells were counterstained with Hoechst 33342 dye (Sigma-Aldrich; Merck KGaA) to identify all nuclei. Images were captured by automated Zeiss AxioImager M2 equipped with an Axiocam MRM (Zeiss GmbH, Jena, Germany). Results are presented as the percentage of stained cells from randomly selected fields.
For mRNA expression analysis, RNA was extracted from GSC and NHA using QIAzol (Qiagen, Inc., Valencia, CA, USA), followed by digestion with DNase I (cat. no. D4263; Sigma-Aldrich; Merck KGaA) digestion step. RNA quality was assessed by determining the
Data are expressed as the fold increase in each gene in GSC compared with NHA, using the 2−ΔΔCq method (
The expression of αvβ3, αvβ5 and α5β1 on cell membranes was determined using FACS analysis with antibodies directed against the integrin receptors. Briefly, following gentle detachment of the cells using a 1 mM EDTA/PBS solution to preserve the integrity of membrane proteins, cells were pelleted at 800 × g for 10 min and resuspended in 1 ml PBS to obtain a suspension of 20,000 cells/ml. The cell suspension was then incubated with the following antibodies (1
To determine apoptosis, an Annexin V-binding assay was used (Annexin V-FITC Apoptosis Detection kit; eBio-science; Thermo Fisher Scientific, Inc.), according to the manufacturer’s protocol. Following treatments, spontaneously detached cells were recovered and stored separately, whereas attached cells were detached using 1 mM EDTA/PBS solution as aforementioned. The suspensions of attached and detached cells were centrifuged at 800 × g for 10 min, and the pellets were suspended in 1 ml Annexin V buffer, according to the manufacturer’s protocol. FITC-conjugated Annexin V was added and cells were incubated for 15 min at room temperature. Following the addition of propidium iodide (PI), samples were acquired using a FACSVantage SE instrument (BD Biosciences, Franklin Lakes, NJ, USA) and analyzed using CellQuest software (version 5.1; BD Biosciences). At least 10,000 events per sample were recorded. Each experiment was performed three times.
Cells were plated in a 96-well plate (10,000 cells/100
The cell viability results were normalized to time-point-matched controls; 1a-RGD stock solution (200 mM in PBS) was diluted in the growth medium and added to the wells. In control wells, only the growth medium was added.
GSC (20,000 cells/well) were plated in culture medium lacking growth factors on a MaxGel (Sigma-Aldrich; Merck KGaA)-coated Transwell (Costar; Corning Incorporated, Corning, NY, USA). As chemoattractants, 500
Cells grown in 60 mm diameter dishes were treated for the indicated times with 25
For the relative quantification of cell death, a colorimetric ELISA sandwich immunoassay was used to detect nucleosomes (Cell Death Detection ELISA; Roche Diagnostics GmbH, Mannheim, Germany). Cells were plated in a 12-well plate and treated with cell culture medium containing 25
Cells were plated on clear-bottomed 96-well black plates (Costar; Corning Incorporated) at a density of 5,000 cells/well. Caspase-3/7 and -9 activities were determined following the addition of growth medium containing 25
Results are expressed as the mean ± standard deviation and analyzed using Student’s t-test when comparing two groups or ANOVA and a Tukey’s post hoc test for comparing more than two groups. Statistical analyses were performed using GraphPad Prism software (version 5.0; GraphPad Software, Inc., La Jolla, CA, USA). P<0.05 was considered to indicate a significant difference.
To characterize and confirm the stemness status of the GSC obtained from specimens from patients with GB, a series of experiments was performed. First, the determination of the stemness markers nestin, MAP2, GFAP and SOX2, in undifferentiated and differentiated GSC was performed by immunostaining (
When GSC3, normally grown in a serum-free medium, were differentiated using 10% FBS, a statistically significant increase (P<0.001) was observed in MAP2- and GFAP-positive cells in comparison with undifferentiated GSC. Conversely, undifferentiated GSC were positive for nestin and SOX2 staining (
The stemness status of the GSC was confirmed further by the transcriptomic analysis of six stemness markers (
Since previous studies have indicated that some RGD-binding integrins are overexpressed in GB (
To further confirm the integrin receptor expression on GSC membranes, FACS experiments were performed using conjugated fluorescent antibodies recognizing αvβ3, αvβ5 and α5β1 integrins. The expression results, reported as specific signal/ isotypic control ratio, are presented in
These results are in good agreement with the mRNA results from the RT-qPCR assay, and the poor expression of β3 subunit may account for the different integrin expression on the cell surface.
Since certain discrepancies concerning the effect of RGD antagonists on cancer cells were identified previously (
After 48 h of treatment with 1a-RGD, a significant decrease was observed in the viability of GSC that was not replicated in the non-tumorigenic NHA control cells (
To verify whether 1a-RGD was responsible for the loss of GSC viability, the extent and type of cell death was investigated separately in adherent and detached cells from the same wells following 1a-RGD treatment (25
Under the same experimental conditions, anoikis onset was determined using two different assays: A nucleosome ELISA assay and a caspase-3/7 activity assay. Treating the cells for 48 h with 25
This supposed function of caspase-3/7 in sustaining anoikis was further confirmed using a fluorimetric caspase activity assay performed under the same experimental conditions. Similar to that observed using the nucleosome assay, the increase in caspase-3/7 activity observed in 1a-RGD-treated GSC was significantly blunted by the caspase inhibitor zVAD-fmk (
Since integrin inhibition has been identified to induce atypical anoikis in glioma cells (
GSC were exposed to 25
The interaction with integrins of several endogenous ECM proteins leads to the activation of a variety of downstream protein kinases, such as FAK, extracellular-signal-regulated kinase (ERK) and Akt (
The features of GSC most implicated in their malignancy are their ability to disseminate, along with their potential invasiveness into the surrounding parenchyma. Since, in some cellular models, the integrin-dependent inhibition of downstream FAK and Akt pathways is functionally associated with a decrease in cell motility, it was investigated whether 1a-RGD affects GSC migration in the experimental model.
A Transwell chamber assay was performed using EGF and bFGF as chemoattractant. Treatment with 25
Integrins are an appealing potential target in cancer biology because they mediate crucial features of tumor malignancy, i.e. detachment from the original tumoral mass, metastatic dissemination and the invasion of distant sites, which culminate in the formation of a new tumoral niche (
Studies performed using
In agreement with a previous study (
The use of suitable and reliable control cells when comparing the expression of specific biomarkers in GSC is currently, for several theoretical and technical reasons, a much-debated and controversial issue that has been poorly addressed in the literature.
Primary cultures of astrocytes represent a valuable tool to study their function in health and disease (
Another notable result obtained in the present study concerns the expression of integrins in GSC: The majority of data available in the literature concerning the expression of RGD-binding integrins were obtained using glioma cell lines grown in the presence of serum, a condition that may not reflect the genotype of cell populations present in the original brain tumor (
Previous studies identified that cilengitide induced detachment-mediated anoikis in pediatric glioma and neuroblastoma cell lines (
The results of the presents study clearly indicate that 1a-RGD induces detachment-mediated anoikis in GSC and that the contribution, if any, of other cell-death-associated mechanisms, such as necrosis and autophagy, appears to be marginal and limited.
Three separate lines of evidence from the present study support this conclusion. First, the cells that remained attached to the wells after 48 h of treatment with 1a-RGD were viable, whereas most of the detached cells had undergone cell death. Secondly, analysis of the detached cells by FACS/Annexin V staining exhibited no increase in the necrotic index in treated cells compared with untreated cells. Finally, the levels of two autophagy markers, LC3 and Beclin-1 (
It was also identified that caspase activity, together with nucleosome formation, was markedly decreased when GSC were simultaneously treated with the pan-caspase inhibitor zVAD-fmk, clearly indicating that the type of anoikis observed in GSC required caspase-3/7 and caspase-9 activation. This result is in contrast with those of Silginer
Integrin-dependent regulation of cellular effects such as survival, growth, migration and resistance to anoikis are mediated by FAK activation by two distinct, but not mutually exclusive, mechanisms: Activation of phosphoinositide 3-kinase (PI3K)/Akt- and ERK-dependent signaling pathways and regulation of the crosstalk between integrins and growth factor receptor signaling (
The results of western blot experiments, obtained using anti-phospho-specific antibodies, indicate that the FAK- and Akt-dependent pathways are likely to serve a significant function in 1a-RGD-dependent anoikis induction and inhibition of cell migration. The experiments of the present study were performed in the presence of 25
Similar mechanisms have been described for other cell types: In fibroblasts, the activation of β1 integrin triggers a viability signal, mediated by the activation of a FAK/PI3K/ Akt-dependent signaling pathway, that protects cells from apoptosis (
The inhibition of GSC migration is an intriguing result, particularly because targeting the ability of GSC to infiltrate distant brain areas, via brain parenchyma or brain vessels (
In this scenario, we hypothesize that, in our model, 1a-RGD may therefore decrease cell migration by inhibiting the release of free active TGF-β from its ternary complex, as has been identified to occur in other cellular systems (
In conclusion, the results of the present study indicate that GSC grown under adherent conditions are a suitable model for investigating the interactions between integrins and SMIA as well as the molecular mechanisms that underlie the functional consequences elicited by this interaction. In addition, the results of the present study identified that the integrin antagonist 1a-RGD induces detachment-mediated caspase-dependent anoikis and markedly inhibits the migration of GSC, supporting the possibility, to be investigated in future studies in
The present study was supported by the Italian Ministry for University and Research by Project of Relevant National Interest 2015 (grant no. 20157WW5EH_006).
All data generated or analyzed during this study are included in this published article.
MP designed the research project and performed part of the experiments; MCG performed part of the experiments and contributed to the experimental design; AD isolated GSC from glioma specimen and characterized the cells performing tumorigenicity and immunocytochemistry experiments; EC performed flow cytometry experiments; MS and LC synthesized 1a-RGD; SS co-ordinated the research activity, contributed to the experimental design and was involved in drafting the manuscript and revising it critically.
Tumor tissues were obtained from the Neurosurgery Department at the Institute for Research, Hospitalization and Care-University Hospital (IRCCS) San Martino-Cancer Research Institute (IST) (Genoa, Italy) following informed consent, according to European Union legislation on informed consent and The Declaration of Helsinki, from the patients and Institutional Ethical Committee (IRCCS San Martino-IST) approval. All experiments involving animals were performed at IRCCS-AOU San Martino-IST in compliance with the guidelines approved by the Italian Ministry of Health and the Committee for Animal Well-Being in Cancer Research.
Not applicable.
The authors have no conflict of interests to declare.
Not applicable.
Expression of nestin, MAP2, GFAP and SOX2 in stemness and differentiating conditions in GSC3. GSC3 grown under stemness and differentiating conditions were stained using antibodies directed against stemness and differentiation markers. Nestin and SOX2 appeared to be predominantly expressed in undifferentiated GSC, whereas MAP2 and GFAP appeared to be primarily expressed by differentiated cells. The experiments were performed in triplicate and 15 fields for each experimental condition were observed (
Stemness markers expressed by GSC. mRNA extracted from GSC3, GSC4, GSC7 and NHA was amplified using the reverse transcription-quantitative polymerase chain reaction. ΔΔCq values were determined using RPL6 as a housekeeping gene. Results are expressed as the fold increase (2−ΔΔCq) of selected genes in GSC compared with NHA. The mean RPL6 Cq values were 20.44 for NHA, 16.22 for GSC3, 16.374 for GSC4 and 16.389 for GSC7. GSC, glioma cancer stem cell; NHA, normal human astrocyte; RPL6, ribosomal protein L6.
Integrin expression in GSC3, GSC4 and GSC7 lines. (A) mRNA extracted from GSC3, GSC4, GSC7 and NHA was amplified using the reverse transcription-quantitative polymerase chain reaction. Results are expressed as the fold increase (2−ΔΔCq) determined using RPL6 as a housekeeping gene. The mean RPL6 Cq values were 20.44 for NHA, 16.22 for GSC3, 16.374 for GSC4 and 16.389 for GSC7. (B) Flow cytometric analysis was performed on GSC3, GSC4, GSC7 and NHA to assess integrin receptor expression on the cell surface. The cell suspensions were incubated with antibodies recognizing the integrin receptors and >10,000 cells for each experimental point were assessed. Results are expressed as antibody signal/isotypic control ratio. *P<0.05 vs. NHA. GSC, glioma cancer stem cell; NHA, normal human astrocyte; RPL6, ribosomal protein L6.
1a-RGD decreases GSC viability after 48 h. of treatment. (A) The three cell lines were treated for increasing times with 25
1a-RGD treatment induces detachment-dependent anoikis. (A) Following treatment with 25
1a-RGD induces anoikis in a caspase-dependent manner. (A) GSC3, GSC4 and GSC7 lines were treated for 48 h with 25
Autophagy is not involved in 1a-RGD-induced anoikis. Following treatment with 25
1a-RGD decreases FAK and Akt phosphorylation. (A) Following treatment with 25
1a-RGD inhibits GSC migration. Cells plated in Transwells were treated with 25
Clinicopathological characteristics of patients and GSC tumorigenic potential in mice.
GSC line | Sex | Age, years | WHO grade | Type | Subtype | OS, months | Mouse survival, days |
---|---|---|---|---|---|---|---|
3 | Male | 48 | IV | Primary | Neural | 14.4 | 120 |
4 | Male | 78 | IV | Secondary | Classical | 13.5 | 80 |
7 | Male | 71 | IV | Primary | ND | 3.6 | 75 |
GSC, glioma cancer stem cell; WHO, World Health Organization; OS, overall survival; ND, not determined.
Primers used to amplify RGD-binding integrin mRNA in reverse transcription-quantitative polymerase chain reaction experiments.
Gene | Accession no. | Primer sequence (5′-3′) |
---|---|---|
αv | NM_002210 | F: actggcttaagagagggctgtg |
R: tgccttacaaaaatcgctga | ||
β3 | NM_000212 | R: tcctcaggaaaggtccaatg |
R: tcctcaggaaaggtccaatg | ||
β5 | NM_002213 | F: agcctatctccacgcacact |
R: cctcggagaaggaaacatca | ||
α5 | NM_002205 | F: cctgctgtccaccatgtcta |
R: ttaatggggtgattggtggt | ||
β1 | NM_133376 | F: tccaatggcttaatttgtgg |
R: cgttgctggcttcacaagta | ||
RPL6 | NM_001024662.1 | F: agattacggagcagcagcgcaagattg |
R: gcaaacacagatcgcaggtagccc |
F, forward; R, reverse; RPL6, ribosomal protein L6.
Primers used to amplify stemness-associated mRNAs in reverse transcription-quantitative polymerase chain reaction assays.
Gene | Accession no. | Primer sequence (5′-3′) |
---|---|---|
CD133 | NM_006017.2 | F: ccaccgctctagatactgctg |
R: cctatgccaaaccaaaacaaa | ||
OCT4 | NM_002701.4 | F: ggtccgagtgtggttctgtaa |
R: atagcctggggtaccaaaatg | ||
MUSASHI | NM_002442.3 | F: actgaagtttcccaccaggat |
R: actgttcatgaaggtccaacg | ||
NANOG | NM_024865.2 | F: cagtctggacactggctgaa |
R: ctcgctgattaggctccaac | ||
BMI1 | NM_005180.6 | F: ggaaagcaggcaagacttttt |
R: caaactatggcccaatgctta | ||
NESTIN | NM_006617.1 | F: gggacaagagaacctggaaac |
R: ggttcacttccacagactcca | ||
SOX2 | NM_003106 | F: ggacttctttttgggggacta |
R: gcaaacttcctgcaaagctc | ||
EZH2 | NM_152998.1 | F: tgccattgctaggttaattgg |
R: acaaccggtgtttcctcttct |
Cells positive for nestin, MAP2, GFAP and SOX2.
GSC line | Nestin | MAP2 | GFAP | SOX2 | |
---|---|---|---|---|---|
3 | Stem | 96 (±2) | 18 (±3) | 25 (±5) | 96 (±5) |
Differentiated | 68 (±4) | 80 (±4) | 89 (±8) | 44 (±6) | |
4 | Stem | 55 (±5) | 5 (±2) | 18 (±5) | 70 (±5) |
Differentiated | 28 (±6) | 32 (±8) | 34 (±8) | 39 (±8) | |
7 | Stem | 95 (±3) | 44 (±5) | 19 (±2) | 88 (±6) |
Differentiated | 75 (±5) | 28 (±5) | 74 (±13) | 39 (±4) |
GSC, glioma cancer stem cell; MAP2, microtubule-associated protein 2; GFAP, glial fibrillary acid protein; SOX2, sex-determining region Y box 2.