Primary CRC specimens were collected from 146 patients who underwent surgery at the Department of Gastroenterological Surgery, Osaka University (Suita, Japan) between January 2011 and December 2012. All patients were clearly diagnosed with CRC, based on the clinicopathological criteria described by the Japanese Society for Cancer of the Colon and Rectum (11). None of the patients received preoperative chemotherapy or radiotherapy. Specimens were fixed in 10% buffered formalin overnight at room temperature, processed through graded ethanol solutions and embedded in paraffin. The follow-up periods ranged between 1 month and 7 years, with a mean of 4 years. All data, including age, sex, tumor size and depth, lymphatic invasion, lymph node metastasis, vascular invasion, liver metastasis, peritoneal dissemination, distant metastasis and histological grade were obtained from clinical and pathological records. The present study was approved by the Research Ethics Committee of Osaka University (approval ID: 08226) and written informed consent was obtained from all patients included in this study.

The human CRC cell lines RKO, HT29, HCT 116, Colo205, SW480 and DLD 1 were purchased from the American Type Culture Collection (Manassas, VA, USA). These cell lines were maintained in Dulbecco's modified Eagle's medium (DMEM; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) containing 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Waltham, MA, USA) at 37˚C in a humidified incubator containing 5% CO₂.

Two types of MAF1-specific small inter fering RNA (siRNA; Sigma Aldrich; Merck KGaA) were used to knockdown MAF1 mRNA. MAF1 siRNAs, or the negative control siRNA, were transfected into RKO and HCT 116 cells, which were seeded at 2×10⁵ cells/well in a 2 ml volume in 6-well flat-bottomed microtiter plates, at a final concentration of 50 nM using Lipofectamine^® 3000 (Invitrogen; Thermo Fisher Scientific, Inc.). These cells were maintained at 37˚C in a humidified incubator containing 5% CO₂ for 48 h, according to the manufacturer's protocol. The sequences of siRNAs against MAF1 were as follows: #1, CCACGCUCAAUGAGU CCUUTT; #2, GGCUCAAGCGAAUCGUCUUTT. The MISSION^® siRNA Universal Negative Control (cat. no. SIC001; Sigma Aldrich; Merck KGaA) was used as a negative control siRNA.

Total RNA was extracted from cultured cells using TRIzol^® RNA Isolation Reagents (Invitrogen; Thermo Fisher Scientific, Inc.) 48 h post-transfection as previously described (12). RNA quality was confirmed (RNA concentra tion >0.5 µg/µl and optical density 260/280=1.8 2.0). cDNA was synthesized from 10 ng total RNA using the ReverTra^® Ace qPCR RT Master Mix (Toyobo Life Science, Osaka, Japan), according to the manufacturer's protocol. qPCR was performed using a LightCycler^® 2.0 system (Roche Applied Science, Penzberg, Germany) and LightCycler^® FastStart DNA Master SYBR Green I (Roche Applied Science). The amplification conditions were as follows: Initial denaturation at 95°C for 10 min, followed by 45 cycles of denaturation at 95°C for 10 sec, annealing at 60°C for 10 sec and extension at 72°C for 10 sec. Data were normalized to the expression of GAPDH, which was used as an internal control for each experiment. The following primers were used: MAF1, sense 5' ctcacagctgactgtggagact 3', antisense 5' aacatgtgtttgtcgtctc ctg 3'; and GAPDH, sense 5' agccacatcgctcagacac 3' and anti sense 5' gcccaatacgaccaaatcc 3'.

Protein expression levels of MAF1 were assessed by immunohistochemical staining of the 146 CRC specimens. The anti MAF1 rabbit antibody (cat. no. HPA058548; Atlas Antibodies AB, Bromma, Sweden) and VECTASTAIN^® Elite ABC Rabbit Immunoglobulin G kit (cat. no. PK 6101; Vector Laboratories, Inc., Burlingame, CA, USA) were used for immunohistochemical staining, according to the manufacturer's protocol. Specimens were fixed in 10% buffered formalin overnight at room temperature, processed through graded ethanol solutions and embedded in paraffin. Tissue sections (3.5 µm) were prepared from paraffin-embedded blocks. Following antigen retrieval in 10 mM citrate buffer (pH 6.0) at 115°C for 15 min using Decloaking Chamber™ NxGen (Biocare Medical, Pacheco, CA, USA), and the slides were incubated overnight at 4°C with the primary antibody at 1:300 dilution, followed by incubation at room temperature for 30 min with the secondary antibody at 1:200 dilution. With reference to the Human Protein Atlas (image available from v18. proteinatlas.org/ENSG00000179632MAF1/tissue/esophagus#img), an intensity score of 2 was assigned to nuclei stained as intensely as normal esophageal mucosa, whereas unstained nuclei were assigned a score of 0. Nuclei that exhibited weaker staining than normal esophageal mucosa were assigned a score of 1. In the subsequent analysis, a score of 0 was defined as the MAF1-negative group, and a score of 1 or 2 was defined as the MAF1 positive group. Staining was reviewed by three independent pathologists without the knowledge of patient outcomes. The specimens were visualized on the light field of a confocal microscope BZ X710 (Keyence Corporation, Osaka, Japan) and were analyzed using a BZ X analyzer (v. 1.3.0.3; Keyence Corporation).

Cells were seeded at a density of 5×10⁵ cells/well in 6 well plates and were grown to confluence under standard conditions. Briefly, a scratch was generated in the cell layer using a 200 µl pipette tip, and the cells were cultured under standard conditions in DMEM supplemented with only 1% FBS to prevent proliferation. Plates were washed with DMEM supplemented with 1% FBS to remove non adherent cells prior to image capture. Images were captured at 0, 24 and 48 h after scratch generation using a confocal microscope BZ X710 (Keyence Corporation) and were analyzed using a BZ X analyzer (v. 1.3.0.3; Keyence Corporation). Cell migration was evaluated by measuring the average distance between the wound edges at 10 random areas.

Cells were seeded at a density of 4×10³ cells/well in 96 well plates and were precultured for 24 h. Subsequently, the cells were exposed to various concentrations of 5 fluouracil (5 FU; Tokyo Chemical Industry Co., Ltd., Tokyo, Japan) and oxaliplatin (L OHP; Yakult Honsha Co., Ltd., Tokyo, Japan) at 37°C in a humidified incubator containing 5% CO₂ for 72 h. The in vitro cytotoxic effects of 5 FU and L OHP were evaluated using the Cell Counting kit 8 (Dojindo Molecular Technologies, Inc., Kumamoto, Japan), according to the manufacturer's protocol. The half maximal inhibi tory concentration values were calculated from the viability data of CRC cells treated with each concentration of L OHP. The results were analyzed using Bioconductor package 'drc' (https://cran.rproject.org/web/packages/drc/index.html) with default settings; this package uses non linear regression models.

Total proteins were extracted from cultured cells using radioimmunoprecipitation assay buffer containing protease and phosphatase inhibitors (Thermo Fisher Scientific, Inc.) and concentration was determined using the bicinchoninic acid method. Briefly, 15 µg proteins were separated by 10% SDS-PAGE and were electrob lotted onto polyvinylidene fluoride membranes (Merck KGaA, Darmstadt, Germany) at 300 mA for 60 min. After blocking with 3% skim milk at room temperature for 1 h, these membranes were incubated with primary antibodies against MAF1 (cat. no. HPA058548; Atlas Antibodies AB), poly (ADP ribose) polymerase (PARP), cleaved PARP, caspase 3, cleaved caspase 3 (apoptosis antibody sampler kit; cat. no. 9915; Cell Signaling Technology, Inc., Danvers, MA, USA) and actin (cat. no. A2066; Sigma Aldrich; Merck KGaA) at 4°C overnight. After incubating with secondary antibodies (1:100,000; cat. no. NA934; GE Healthcare, Little Chalfont, UK), the protein bands were detected using the Amersham Enhanced Chemiluminescence Prime Western Blotting Detection Reagent (GE Healthcare).

Experiments were conducted in triplicate, and data are presented as the means ± standard deviation. The Cancer Genome Atlas (TCGA) mRNA expression data and clinical information were downloaded from the GDAC Firehose website (http://gdac.broadinstitute.org); the colorectal adenocarcinoma data set (COADREAD) (n=615) was used. Regulatory T cell (Treg) infiltration in each sample was calculated using CIBERSORT (http://cibersort.stanford.edu) (13,14). R programming language v3.5.0, JMP^® Pro 13.2.1 (SAS Institute Inc., Cary, NC, USA) and Microsoft^® Excel^® Version 14.7.1 (Microsoft Corporation, Redmond, WA, USA) were used for analysis. Overall survival (OS) rates and relapse free survival (RFS) rates were calculated according to the Kaplan Meier method and were measured from the day of surgery. Differences between groups were estimated using χ² test, Student's t test, one way analysis of variance followed by post hoc Dunnett test, or the log rank test. For univariate and multivariate analyses of clinicopathological factors, variables with P<0.05 in the univariate analysis were used in a subsequent multivariate analysis based on the Cox proportional hazards regression model. P<0.05 was considered to indicate a statistically significant difference.

Of the 146 CRC cases, 97 cases were classified as MAF1-positive (52 cases with strong staining and 45 cases with weak staining), whereas 49 cases were classified as the MAF1 negative (Fig. 1A). A clinicopathological analysis demonstrated that high MAF1 expression was associated with tumor malignancy, including tumor depth, lymph node metastasis, distant metastasis and a poorer cancer stage (Table I). Kaplan Meier curves for OS (n=146) and RFS (n=130) revealed that the MAF1 positive group exhibited a significantly poorer prognosis (P=0.0123) and higher relapse rate (P=0.0132) compared with the MAF1 negative group (Fig. 1B and C). Univariate analysis indicated that tumor depth, lymph node metastasis, lymphatic invasion, venous invasion and MAF1 expression were prognostic factors for overall survival, whereas multivariate analysis revealed that tumor depth, lymph node metastasis and venous invasion were independent prognostic factors (Table II).

To elucidate how MAF1 contributes to the malig nant potential of CRC, in vitro loss of function assays were performed using RNA interference. HCT 116 and RKO CRC cell lines were used for MAF1knockdown experiments, since they exhibited relatively high expression levels of MAF1 in the CRC cell lines investigated (Fig. 2A). Knockdown efficiency was confirmed using RT-qPCR and western blotting (Fig. 2B). Subsequently, MAF1 knockdown significantly inhibited the migratory ability of HCT 116 and RKO cells (Fig. 2C), whereas proliferation rate was not affected (data not shown). To further investigate the involvement of MAF1 in CRC progression, the association between drug resistance of cancer cells and MAF1 expression was explored. The results from the chemosensitivity assay revealed that knockdown of MAF1 significantly improved chemosensitivity to L-OHP, which is one of the standard chemotherapy drugs used to treat CRC (Fig. 3A), whereas chemosensitivity to 5 FU was not affected (data not shown). Western blotting was performed to confirm the enhanced induction of apoptosis in MAF1 knockdown cells treated with L OHP. Knockdown of MAF1 markedly enhanced the expression of cleaved PARP and caspase 3 in L OHP treated cells, thus demonstrating that MAF1 may be critically involved in the avoidance of CRC cell apoptosis following exposure to cytotoxic agents (Fig. 3B).

To further evaluate the clinical significance and prognostic impact of MAF1 expression in CRC, the present study analyzed a large scale CRC dataset from TCGA (n=615), which consisted of 87 MSI positive cases and 528 non MSI cases. Since Pol III activity is closely associated with immune response in various cell types (15,16), this study focused on MAF1 expression and MSI status, which strongly affects activation of tumor immunity. 'MSI high' samples were considered MSI positive, whereas all other samples were categorized in the non MSI group; this is because of the differences in clinical and immunological behaviors between MSI high tumors and other tumors (17,18). In the subgroup analysis using MSI status information, the prognostic impact of MAF1 was significantly higher in MSI positive cases (P=0.00845) compared with all cases (P=0.0146) or non MSI cases (P=0.157) (Fig. 4A C). Multivariate analysis of MSI positive cases (n=87) indicated that high MAF1 expression was an independent prognostic factor for overall survival (Table III). To further investigate the association between MAF1 expression and the immune microenvironment, bioinformatics analysis was performed using CIBERSORT (13,14). CIBERSORT is a computational program used to predict the relative contribution of each immune cell type in a mixed cell population using transcriptome data (13,14). A mild correlation between MAF1 expression and Treg infiltration was detected (Fig. 4D), and the extent of Treg infiltration was significantly higher in the MAF1 high expression group in the TCGA dataset (P<0.0001; Fig. 4E).