ETM Experimental and Therapeutic Medicine 1792-0981 1792-1015 D.A. Spandidos 10.3892/etm.2016.3717 ETM-0-0-3717 Articles A novel KRT5 mutation associated with generalized severe epidermolysis bullosa simplex in a 2-year-old Chinese boy ZhangJia * YanMing * LiangJianying LiMing YaoZhirong Department of Dermatology, Xinhua Hospital Affiliated to Shanghai Jiaotong University School of Medicine, Shanghai 200092, P.R. China Correspondence to: Professor Zhirong Yao or Dr Ming Li, Department of Dermatology, Xinhua Hospital, Shanghai Jiaotong University School of Medicine, 1665 Kongjiang Road, Shanghai 200092, P.R. China, E-mail: zryaosmu@sohu.com, E-mail: aypyslm@163.com

Contributed equally

 11 2016 20 09 2016 12 5 2823 2826 14042015 11052016 Copyright: © Zhang et al. 2016 This is an open access article distributed under the terms of the Creative Commons Attribution-NonCommercial-NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

Mutations in keratin 5 (KRT5) or KRT14 genes are responsible for the most severe form of epidermolysis bullosa simplex (EBS), which is EBS generalized severe (EBS-gen sev). To date, only four pathogenic mutations (p.Arg165Ser and p.Lys199Asn in KRT5; p.Arg125Cys and p.Arg125His in KRT14) have been reported to be responsible for EBS-gen sev in the Chinese population. In the present study, a 2-year-old Chinese boy was clinically suspected to suffer from EBS, and thus Sanger sequencing was performed in the extracted genomic DNA samples from the patient, his parents and 100 healthy controls. A novel de novo heterozygous missense mutation c.503A>G (p.Glu168Gly) located at the N-terminal end segment of the 1A domain in KRT5 was identified by molecular analysis. In silico analysis tools were used to predict the pathogenicity of the novel missense mutation. A diagnosis of EBS-gen sev was thus confirmed according to the clinical presentations and molecular results.

 epidermolysis bullosa simplex mutation analysis keratin 5 Introduction

Epidermolysis bullosa simplex (EBS) refers to a number of inherited disorders characterized by mechanical stress-induced blistering of the skin (1). EBS comprises three primary types: Localized [EBS-loc; Online Mendelian Inheritance in Man (OMIM) no. 131800], generalized severe (EBS-gen sev; OMIM no. 131760) and generalized intermediate (EBS-gen intermed; OMIM no. 131900) (1). The ultrastructural pathogenesis of EBS-gen sev is the collapse of keratin filaments in basal epidermal cells, resulting in basal cell cytolysis and sequent intraepidermal blister formation, which can differ from other subtypes (2–4). EBS-gen sev typically presents with characteristic features of large, generalized blisters in early infants, and small, clustered (herpetiform) blisters in childhood. In neonates and infants, EBS-gen sev is life-threatening as cutaneous lesions are typically severe, resulting in difficulties in feeding and care (5–7). Subsequent to infancy, particularly during late childhood and adulthood, the prognosis is favorable (5–7). Mutations located at the highly conserved α-helical end segments of the 1A domain of keratin 5 (KRT5) and 2B domain of KRT14, also known as helix initiation peptide (HIP) and helix termination peptide (HTP), respectively, typically result in EBS-gen sev (8,9). To date, four pathogenic mutations have been reported to be responsible for EBS-gen sev in the Chinese population, including p.Arg165Ser and p.Lys199Asn in KRT5, and p.Arg125Cys and p.Arg125His in KRT14 (10–13).

In the present study, molecular genetic tests were performed in a 2-year-old boy with suspected EBS, and a novel missense mutation c.503A>G (p.Glu168Gly) located at the N-terminal end segment of the 1A domain of KRT5 (HIP) confirmed a diagnosis of EBS-gen sev.

 Materials and methods <sec> <title>Case

The proband was a 2-year-old boy that was referred to the Department of Dermatology of Xinhua Hospital (Shanghai, China) in October 2013. The patient had been reported to present generalized blisters throughout his body since birth (Fig. 1A-D), which were worsened by friction or trauma and were not treated. No other symptoms were observed other than blisters. At the 9-month follow-up visit a dermatological examination showed that there was no evident improvement (Fig. 1E and F). No other relevant medical history and consanguinity was reported in the patient's family. The patient was suspected to have EBS based on the clinical manifestations, and Sanger sequencing was performed to clarify the diagnosis.

 Subjects

The proband, his parents and 100 population-matched healthy controls (the mean age of the healthy controls was 24 years old with a range between 18 to 30 years old and a gender ratio of females/males equal to 1.0) were enrolled in the present study. Subsequent to obtaining written informed consent from the participant's mother, peripheral blood samples were collected for DNA extraction. The present study was approved by the Institutional Review Board of Xinhua Hospital, Shanghai Jiaotong University School of Medicine, and was conducted in accordance with the principles of the Declaration of Helsinki. Ethical approval was obtained from the Ethics Committee of the Xinhua Hospital Affiliated to Shanghai Jiao Tong University School of Medicine.

 Methods

Genomic DNA was extracted using a TIANamp Blood DNA kit (Tiangen Biotech Co., Ltd., Beijing, China). Primers flanking all coding exons and intron-exon boundaries of KRT5 and KRT14 were designed using Primer Premier version 5.0 (Premier Biosoft, Palo Alto, CA, USA; Table I). Genomic DNA samples were amplified using polymerase chain reaction (PCR). PCR was performed as follows: A denaturation step at 94°C for 5 min; 31 cycles of denaturation at 94°C for 30 sec, an annealing step for 30 sec (temperature was according to the primers of each fragment), an extension at 72°C for 1 min and an extension at 72°C for 1 min. Next, a final extension step was performed at 4°C for 5 min, and the experiment was repeated 10–20 times. The PCR products were evaluated by a 2% agarose gel electrophoresis and were further purified using an AxyPrep DNA Gel Extraction kit (Corning Life Sciences, Corning, NY, USA), according to the manufacturer's instructions. Sanger sequencing was subsequently performed using an ABI PRISM 3730 automated sequencer (Applied Biosystems; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Sequencing results were analyzed by Geneious version 5.6.7 software (Biomatters, Ltd., Auckland, New Zealand). An identified mutation was verified in the corresponding region of the unaffected parents of the proband and 100 population-matched healthy controls. The mutation was described by comparison with the NCBI cDNA reference sequences NM_000424.3 for KRT5 and NM_000526.4 for KRT14.

The potential impact of an amino acid substitution on the structure and function of KRT5 and KRT14 proteins was predicted using the following in silico analysis tools: PolyPhen2 (http://genetics.bwh.harvard.edu/pph2), SIFT (http://sift.bii.a-star.edu.sg) and Mutation Taster (http://www.mutationtaster.org/), which automatically generated the results following input.

 Results <sec> <title>Sequencing results

The results of the present study indicated that mutation sequencing of KRT14 was negative, whereas a novel heterozygous missense mutation, c.503C>T (p.Glu168Gly), in KRT5 was presented in the patient. This mutation was absent in the patient's unaffected parents and the 100 population-matched healthy controls (Fig. 2).

 Functional consequence predictions

Analysis using PolyPhen2 indicated that the mutation c.503A>G (p.Glu168Gly) was ‘probably damaging’. Furthermore, SIFT and Mutation Taster software predicted the mutation to be ‘deleterious’ and ‘disease causing’, respectively.

 Discussion

The locus of the mutation in KRT5 serves an important role in the phenotype of EBS-gen sev. The majority of causal variants of EBS-gen sev in KRT5 are missense mutations that exist in the highly conserved regions of HIP and HTP (which are critical for the intermediate filament structure and integrity of the keratin cytoskeleton), and exert a dominant negative effect on the functional protein structure (2,8,9,14). Mutations in other regions are typically associated with the milder subtypes of EBS, namely EBS-loc and EBS-gen intermed (2,8,14).

The Glu168 site (codon, GAG) is located at the boundary between the head and 1A domain (HIP) (Fig. 3). To date, three relevant substitutions have been reported. More specifically, mutations c.504G>T (p.Glu168Asp) and c.504G>C (p.Glu168Asp) result in EBS-gen intermed, while c.502G>A (p.Glu168Lys) is responsible for EBS-gen sev (15–17). Phenotype severity may be explained by the fact that Glu and Asp are acidic amino acids that share a similar structure and polarity, while Lys and Gly are very different with regards to these features. Contrary to Arg125Cys and Arg125His in the Arg125 site (a CpG-rich hotspot codon) accounting for the majority of mutations in KRT14 (8,16,18), Glu477Lys located at the C-terminal end segments of the helix 2B domain (HTP) was the most common mutation identified in KRT5 (19). This was more common than the corresponding region, Glu168 (Fig. 3; 8,14,16–18).

Dowling-Degos disease (DDD; OMIM no. 179850) or Galli-Galli disease (an acantholytic variant of DDD) are associated with haploinsufficiency of KRT5 caused by heterozygous frameshift/nonsense mutations (such as p.Met1?, p.Gln4* and p.Ile140Asnfs*39) in the head domain of KRT5 (20–22). Furthermore, p.Pro25Leu (in the head domain) and p.Gly550Alafs*77 (in the tail domain) result in a rare subtype of EBS, known as EBS with mottled pigmentation (OMIM no. 148040), suggesting that specific regions in KRT5 may be associated with melanin transportation and distribution, and malfunction of which can result in pigmentary phenotypes (20,23).

Although variable phenotypes can arise from distinct KRT5 mutations, even from an identical mutation in one pedigree (13), substitutions in the Glu168 site primarily result in the most severe subtype of EBS, which is EBS-gen sev. However, there exist exceptions (for instance, Glu168Asp results in EBS-gen intermed), suggesting that other factors, such as epigenetic alterations, interchain interactions of protein structure, modifier genes, environmental interference and ethnic background, may exert effects that result in distinct phenotypes.

In the present study, it can be suggested that Glu168Gly is the pathogenic mutation present in the proband based on the following: i) Glu168 is highly conserved among different species (analyzed by the Mutation Taster software; (www.mutationtaster.org/); ii) functional consequence predictions are deleterious; iii) other pathogenic mutations in Glu168 have been reported (Fig. 3); and iv) the variant was not present in the patient's unaffected parents and 100 healthy controls. In combination with the generalized herpetiform blistering occurring since birth and improving with age, the 2-year-old male in the present study was diagnosed with EBS-gen sev.

The patient did not evidently improve after 9 months from the first time that they appeared at the Department of Dermatology of Xinhua Hospital (Shanghai, China), and this may be attributed to the relatively long-term clinical course of EBS-gen sev, or due to insufficient general management of EBS in the infant. Furthermore, no treatment was given within these 5 months. Subsequent general therapy of EBS-gen sev in this patient should concern the prevention of skin trauma, infection control and the maintenance of good nutrition. Since a favorable lifelong prognosis of EBS-gen sev is anticipated following the high mortality rate period (within a year from birth), prenatal diagnosis and potential gene therapy will be available to the next generation in the family.

In conclusion, the current study successfully confirmed a diagnosis of EBS-gen sev by revealing a novel de novo heterozygous missense mutation c.503A>G in the HIP of KRT5, expanding the existing mutation spectrum.

 Acknowledgements

The authors would like to thank all subjects for their ongoing participation in the study. The present study was supported by grants from the PhD Programs Foundation of the Ministry of Education of China (grant no. 20130073120014) and the Natural Science Foundation of Shanghai Jiaotong University School of Medicine (grant no. 13XJ10023).

 References FineJDBruckner-TudermanLEadyRABauerEABauerJWHasCHeagertyAHintnerHHovnanianAJonkmanMFInherited epidermolysis bullosa: Updated recommendations on diagnosis and classificationJ Am Acad Dermatol7011031126201410.1016/j.jaad.2014.01.90324690439 CoulombePAHuttonMEVassarRFuchsEA function for keratins and a common thread among different types of epidermolysis bullosa simplex diseasesJ Cell Biol11516611674199110.1083/jcb.115.6.16611721910 CoulombePAHuttonMELetalAHebertAPallerASFuchsEPoint mutations in human keratin 14 genes of epidermolysis bullosa simplex patients: Genetic and functional analysesCell6613011311199110.1016/0092-8674(91)90051-Y1717157 HiremagaloreRKubbaABanselSJerajaniHImmunofluorescence mapping in inherited epidermolysis bullosa: A study of 86 cases from IndiaBr J Dermatol172384391201510.1111/bjd.1330525070151 IntongLRMurrellDFInherited epidermolysis bullosa: New diagnostic criteria and classificationClin Dermatol307077201210.1016/j.clindermatol.2011.03.01222137229 FineJDJohnsonLBWeinerMLiKPSuchindranCEpidermolysis bullosa and the risk of life-threatening cancers: The National EB Registry experience, 1986–2006J Am Acad Dermatol60203211200910.1016/j.jaad.2008.09.03519026465 SawamuraDNakanoHMatsuzakiYOverview of epidermolysis bullosaJ Dermatol37214219201010.1111/j.1346-8138.2009.00800.x20507384 YasukawaKSawamuraDGotoMNakamuraHJungSYKimSCShimizuHEpidermolysis bullosa simplex in Japanese and Korean patients: Genetic studies in 19 casesBr J Dermatol155313317200610.1111/j.1365-2133.2006.07285.x16882168 SteinertPMMarekovLNFraserRDParryDAKeratin intermediate filament structure: Crosslinking studies yield quantitative information on molecular dimensions and mechanism of assemblyJ Mol Biol230436452199310.1006/jmbi.1993.11617681879 LiXLXiaoSXPengZHLiuYPanMZhouSNA mutation in exon 1 of keratin 14 resulting in a Chinese family with epidermolysis bullosa simplex Dowling-MearaJ Eur Acad Dermatol Venereol21979981200710.1111/j.1468-3083.2006.02050.x17659012 YuanHLiuFXiaoBHeYLiangYLiuJMutation screening of entire keratin 5 and keratin 14 genes and identification of a novel mutation in a Chinese family with epidermolysis bullosa simplex Dowling-MearaJ Eur Acad Dermatol Venereol2215101512200810.1111/j.1468-3083.2008.02687.x18384561 WuJWXiaoSXA recurrent keratin 14 mutation in Dowling-Meara epidermolysis bullosa simplex in a Chinese familyJ Eur Acad Dermatol Venereol23484486200910.1111/j.1468-3083.2008.02930.x18717745 DengWYuanPLaiWChenMWangYDaiSA novel KRT5 mutation, p. Lys199Asn, is associated with three subtypes of epidermolysis bullosa simplex phenotypes in a single Chinese familyJ Dermatol Sci64241243201110.1016/j.jdermsci.2011.09.00322005030 KangTWLeeJSKimSEOhSWKimSCNovel and recurrent mutations in Keratin 5 and 14 in Korean patients with Epidermolysis bullosa simplexJ Dermatol Sci579094201010.1016/j.jdermsci.2009.12.00220060687 ShinkumaSNishieWJacykWKNatsugaKUjiieHNakamuraHAkiyamaMShimizuHA novel keratin 5 mutation in an african family with epidermolysis bullosa simplex indicates the importance of the amino acid located at the boundary site between the H1 and coil 1A domainsActa Derm Venereol93585587201310.2340/00015555-153823450297 MüllerFBKüsterWWodeckiKAlmeidaHJrBruckner-TudermanLKriegTKorgeBPArinMJNovel and recurrent mutations in keratin KRT5 and KRT14 genes in epidermolysis bullosa simplex: Implications for disease phenotype and keratin filament assemblyHum Mutat27719720200610.1002/humu.9437 MurrellDFTrisnowatiNMiyakisSPallerASThe yin and the yang of keratin amino acid substitutions and epidermolysis bullosa simplexJ Invest Dermatol13117871790201110.1038/jid.2011.20621844930 BollingMCLemminkHHJansenGHJonkmanMFMutations in KRT5 and KRT14 cause epidermolysis bullosa simplex in 75% of the patientsBr J Dermatol164637644201121375516 StephensKEhrlichPWeaverMLeRSpencerASybertVPPrimers for exon-specific amplification of the KRT5 gene: Identification of novel and recurrent mutations in epidermolysis bullosa simplex patientsJ Invest Dermatol108349353199710.1111/1523-1747.ep122864869036937 BetzRCPlankoLEigelshovenSHannekenSPasternackSMBussowHVan Den BogaertKWenzelJBraun-FalcoMRuttenALoss-of-function mutations in the keratin 5 gene lead to Dowling-Degos diseaseAm J Hum Genet78510519200610.1086/50085016465624 GuoLLuoXZhaoAHuangHWeiZChenLQinSShaoLXuanJFengGA novel heterozygous nonsense mutation of keratin 5 in a Chinese family with Dowling-Degos diseaseJ Eur Acad Dermatol Venereol26908910201210.1111/j.1468-3083.2011.04115.x21569119 LiaoHZhaoYBatyDUMcGrathJAMellerioJEMcLeanWHA heterozygous frameshift mutation in the V1 domain of keratin 5 in a family with Dowling-Degos diseaseJ Invest Dermatol127298300200710.1038/sj.jid.570052316917491 PlankoLBöhseKHöhfeldJBetzRCHannekenSEigelshovenSKruseRNöthenMMMaginTMIdentification of a keratin-associated protein with a putative role in vesicle transportEur J Cell Biol86827839200710.1016/j.ejcb.2007.02.00417397964

Clinical images of the patient in the current study. (A and B) Dystrophic or absent nails and plantar hyperkeratosis present on the first visit. (C and D) Widespread herpetiform skin blistering with post-inflammatory pigmentation over the entire body. Images A-D were captured when the child was 22 months old. No scarring is present. (E and F) Cutaneous lesions developed after 9 months. Images E and F were captured when the child was 31 months old.

Sequencing results. A novel de novo heterozygous missense mutation c.503A>G (p.Glu168Gly) in the kerain 5 gene was identified by molecular analysis. The arrow indicates the site of mutation. (A) The proband, (B) his father and a (C) normal control.

Domain information of the keratin 5 gene and a number of mutations in HIP and HTP responsible for epidermolysis bullosa simplex, generalized severe. The mutation identified in the current study is highlighted red. HIP, helix initation peptide; HTP, helix termination peptide.

List of the primers of the KRT5 and KRT14 genes.

Primer name Primer Sequence Annealing temperature (°C)
keratin 5-E01_F TGGGTAACAGAGCCACCTTC
keratin 5-E01_R TTGCACAAAGCCAAAACATC 55
keratin 5-E02_F TAGAGGGACGGAAAGAGGTG
keratin 5-E02_R GGAGGTGTCCATGGAAGGTA 59
keratin 5-E03+4+5_F CCCTTCCCACTGCAAAAGTA
keratin 5-E03+4+5_R GAGCCCCATTCTTAGTGTCG 57
keratin 5-E06+7_F AACCAGCCCCACACTATTTG
keratin 5-E06+7_R AGCAGCTTCGCTTTATCAGC 57
keratin 5-E08_F CGAATCATGAGGATGGGAGT
keratin 5-E08_R GGGATGGGAAAAGTTTGGAT 55
keratin 5-E09_F AGGGGGTCCAGTAGAGTGCT
keratin 5-E09_R TTCTGCAATTGGCTTGGTCT 57
keratin 14-E01_F GACAGACATGATGAGGCGGAT
keratin 14-E01_R CTGCCTCCTGTGCTGGAAGG 65
keratin 14-E02+3_F CCTTCCAGCACAGGAGGCAG
keratin 14-E02+3_R CAGCGGATTGGTGTTCCTTAG 64
keratin 14-E04−8_F TGGTGGAACTCCTGACTGTGG
keratin 14-E04−8_R CCATGAACCCCATGACATTG 60.8

F, forward; R, reverse.