A total of 10 tissues samples from patients with gastric cancer (6 men and 4 women) between February 2010 and October 2012 were obtained at the Third People's Hospital of Qingdao (Qingdao, China). Ten normal gastric mucosa tissues (a distance away from the resected margin of gastric cancer) were obtained from these patients to use as a control. All samples were confirmed by pathological analysis and were not treated with radiotherapy and chemotherapy prior to surgery. The median age in the cohort of patients was 55.3±5.9 years (range, 47.6–57.6 years). All samples were stored at −80°C for further analysis. Written informed consent was obtained from all the patients. The study was conducted with approval from the Ethics Committee of the Third People's Hospital of Qingdao.

Roswell Park Memorial Institute (RPMI)-160 culture medium, fetal bovine serum (FBS) and double antibody (penicillin-streptomycin) were obtained from Gibco (Thermo Fisher Scientific, Inc., Waltham, MA, USA). PADI4 and GAPDH sheep anti-rabbit antibodies, and secondary antibody, were obtained from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA). Radioimmunoprecipitation assay (RIPA) lysis buffer, polyvinylidene difluoride (PVDF) membrane and Bradford Protein Quantitative kit were purchased from Beyotime Institute of Biotechnology (Jiangsu, China). Enhanced Chemiluminescence (ECL) kit was obtained from Invitrogen (Thermo Fisher Scientific, Inc.). Bovine serum albumin (BSA) was obtained from Sangon Biotechnology Co., Ltd. (Shanghai, China). Total RNA Extraction kit was obtained from Omega Bio-tek, Inc. (Doraville, GA, USA). Quantitative PCR kit and SYBR Green qPCR Master Mix was obtained from Hoffmann-La Roche, Inc. (Basel, Switzerland). 5-Fu was obtained from Anji Haosen Pharmaceutical Co., Ltd. (Jiangsu, China).

Human gastric cancer cell lines (SGC-7901 and AGS) were cultured in RPMI-1640 supplemented with 10% FBS at 37°C with 5% CO₂ in a humidified atmosphere. Cells in logarithmic growth phase were resuspended and seeded in a 6-well plate at a density of 5×10⁵ cells/ml. Subsequently, transient transfection was performed when cells reached 80% confluence. For the experimental transfection, samples were divided into the following groups: Mock group (subjected to transfection reagent); negative group (subjected to siRNA transfection); PADI4 siRNA group (subjected to PADI4 siRNA transfection); 5-Fu group (subjected to 5-Fu); and 5-Fu⁺ siRNA transfection group (treated with 5-Fu and subjected to PADI4 siRNA transfection). All transfection procedures were performed according to the manufacturer's instructions of Lipofectamine 2000. The interference sequences in the PADI4 siRNA and negative group were as follows: siPADI4 sense, 5′GAAGGAGUUUCCCAUCAAATT'3 and antisense, 5′UUUGAUGGGAAACUCCUUCAG'3; negative control sense, UUCUCCGAACGUGUCACG and antisense, 5′ACGUGACACGUUCGGAGAATT'3.

Fresh tissues were cut into sections and lysed in RIPA buffer on ice. Cell lysates were centrifuged at 12,000 rpm for 10 min, and the protein supernatant was transferred into new tubes. Subsequently, the protein concentration of each sample was determined using BCA Protein Assay kit (Pierce; Thermo Fisher Scientific, Inc.). For SDS-PAGE, 20 µg of the total protein from each sample was resolved using 12% SDS-PAGE and transferred to PVDF membranes for 45 min using a tank transfer system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Then, the membranes were blocked in Tris-buffered saline containing Tween 20 (TBST) with 3% BSA at 37°C for 1 h, and incubated with PADI4 primary antibody (1:500; cat. no. sc-365369) overnight at 4°C. After washing three times with TBST, the membranes were incubated with anti-rabbit secondary antibody (1:500; cat. no. sc-98991) for 1 h at room temperature. Proteins were detected using an ECL kit according to the manufacturer's instructions. GAPDH was used as an internal control.

Total RNA from the gastric tissues was extracted with TRIzol reagent according to the manufacturer's instructions as previously described (15). cDNA synthesis was performed with ~500 ng RNA using the Superscript RT kit (Invitrogen; Thermo Fisher Scientific, Inc.). RT-qPCR amplification was performed using the Mx3000P QPCR System (Agilent Technologies, Inc., Santa Clara, CA, USA) with the primers listed in Table I. As an internal control for qPCR, GAPDH mRNA expression was amplified from the same cDNA samples. All results were normalized to GAPDH amplification. PCR reactions were performed in a total volume of 20 µl, containing 15 µl 1X SYBR Green Supermix, 1 µl each specific primer, 2 µl water and 1 µl cDNA template. The amplification reaction conditions were as follows: Pre-denaturation at 90°C for 3 min; followed by 40 cycles of denaturation at 94°C for 30 sec; annealing at 30°C for 30 sec; and extension at 72°C for 40 sec. The 2^−ΔΔCq method was applied to analyze the relative changes in gene expression from RT-qPCR experiments, as previously described (16).

An MTT assay was performed to determine the effect of PADI4 on the cellular growth of SGC-7901 and AGS cells, as previously described (17). Briefly, SGC-7901 and AGS cells at a density of 5×10³ cells/ml were seeded in 96-well plates and cultured with the various transfections or 5-Fu, as described above, for 24, 48 and 72 h. Subsequently, 20 µl of MTT (5 mg/ml; Gefan Biotech, Shanghai China) was added to each well and incubated for 4 h at 37°C. Then, 150 µl dimethyl sulfoxide was added to each well, and the mixture was shaken in a horizontal direction for 10 min to dissolve the produced formazan crystals. The optical density (OD) value at 490 nm of each sample was measured using a plate reader.

Cell cycle was determined by flow cytometry, as previously described (18). Briefly, cells in the logarithmic growth phase were collected subsequent to transfection with PADI4 siRNA for 48 h. Cells were fixed with 70% ethanol for 24 h followed by washing in PBS three times. Subsequently, cells were treated with 50 µl RNAse solution (0.5 mg/ml) at 37°C for 30 min. Then, cells were incubated with propidium iodide (50 µg/ml) for staining at 4°C for 30 min under dark conditions and filtered with a stainless steel screen (200 mesh). The cell cycle of each sample was detected using flow cytometry. Experiments were repeated three times.

Cell invasion was identified using a Transwell cell culture chamber (8 µm; Corning Incorporated, Corning, NY, USA), as previously described (19). Briefly, SGC-7901 and AGS cells were suspended in serum-free RPMI-l640 culture medium at a concentration of 1×10⁵ cells/ml following transfections, as described above. Cell suspension (200 µl) was then added to the upper chamber (2×10⁴ cells/well). Simultaneously, RPMI-1640 media supplemented with 20% FBS was added to the lower compartment. Then, the Transwell chamber was incubated at 37°C in a 5% CO₂ atmosphere for 24 h. Subsequently, cells in the upper compartment were collected and fixed with formaldehyde solution. Following staining with hematoxylin and eosin, five fields of each image were randomly selected at higher magnification using a confocal microscope, and the number of cells were calculated. Each assay was repeated three times.

Statistical analyses were performed by one-way analysis of variance using SPSS version 13.0 (SPSS, Inc., Chicago, IL, USA). Data are presented as mean ± standard deviation. Student's t-test was performed to evaluate inter-group comparisons. P<0.05 was considered to indicate a statistically significant difference.

Fig. 1 presents the expression levels of PADI4 in gastric cancer and normal mucosa tissues. A significant increase in PADI4 protein mRNA expression levels were identified in gastric cancer tissue compared with normal mucosa tissue (P<0.05; Fig. 1). Furthermore, the expression of PADI4 (1.367±0.268) in gastric cancer tissue was significantly higher compared with normal mucosa tissue (0.429±0.335), analyzed by RT-qPCR analysis (P<0.05).

Following silencing PADI4 with siRNA, the expression level of PADI4 was markedly decreased compared with the mock and negative group (Fig. 2A). A significant decrease (P<0.05) in the proliferation of SGC-7901 and AGS cells in the PADI4 siRNA group was identified in comparison with the mock and negative groups at 36 and 48 h (Fig. 2B). In addition, marked S phase arrest and a marked decrease in the number of gastric cancer cells in the G2/M phase was identified in the PADI4 siRNA group (Fig. 3). Furthermore, the invasion of SGC-7901 and AGS cells were markedly decreased when treated with PADI4 siRNA (Fig. 4).

After silencing PADI4 in SGC-7901 cells, MMP2 and MMP9 expression levels were lower compared with the mock and negative control groups (Fig. 2A).

A marked decrease was observed in the proliferation of gastric cancer cells in the PADI4 siRNA, 5-Fu and PADI4 siRNA + 5-Fu groups compared with the mock and control groups. The inhibitory effect was most prominent when PADI4 siRNA and 5-Fu were combined. Furthermore, a significant difference (P<0.05) was identified in the combination group at 36 h compared with the PADI4 siRNA group and the 5-Fu group (Fig. 5).