A375 human melanocytes were obtained from the Cell Resource Center, Shanghai Institutes for Biological Science, Chinese Academy of Sciences. A375 cells were cultured in Dulbecco's modified Eagle's medium (HyClone; GE Healthcare) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.), penicillin (100 U/ml) and streptomycin (100 U/ml), in a 5% CO₂ incubator at 37°C.

Two sgRNA target sequences [sgCDK2-108 (TGTTCGTACTTACACCCATG) and sgCDK2-110 (CAGAAACAAGTTGACGGGAG)] for the CDK2 gene (NM_001798) were designed, and a non-silencing sgRNA sequence (CGCTTCCGCGGCCCGTTCAA) was used as negative control (sgCDK2-NC). sgRNA constructs were synthesized and cloned into Lenti-CAS9-sgRNA-EGFP vector with BsmBI sites (GeneChem). The CDK2-sgRNA plasmids were transfected into 293T cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. The packaging lentivirus particles expressing CDK2-sgRNA were harvested after transfection for 72 h. Lentivirus was concentrated using the Centricon Plus-20 centrifugal ultrafiltration device (EMD Millipore), and stored at −80°C for further use.

A375 cells were seeded in 6-well plates and infected with sgCDK2 lentivirus or sgCDK2-NC lentivirus at multiplicity of infection (MOI) of 10, supplemented with polybrene (Santa Cruz Biotechnology, Inc.) when the confluency of A375 cells reached 30%. The culture medium was refreshed after 12 h. The lentiviral infection efficiency was determined through observing GFP fluorescence expression under a fluorescence microscope (Olympus Corporation) at 72 h post-infection.

Total RNA was extracted using TRIzol reagent (15596026; Thermo Fisher Scientific, Inc.) from A375 cells following infection by lentivirus for 72 h. cDNA was synthesized by a high-capacity cDNA reverse transcription kit (4368814; Thermo Fisher Scientific, Inc.) following the manufacturer's instructions. The primers used for qPCR were as follows: CDK2, forward 5′-TTCTATGCCTGATTACAAGCC-3′ and reverse 5′-CTGGCTTGGTCACATCCT-3′; CDK4, forward 5′-CTGGTGACAAGTGGTGGAACAGTC-3′ and reverse 5′-GGTGTAAGTGCCATCTGGTAGCTG-3′; cyclin D1, forward 5′-TACCGCCTCACACGCTTCCTC-3′ and reverse 5′-ACCTCCTCCTCCTCCTCTTCCTC-3′; cyclin A2, forward 5′-AGAAACAGCCAGACATCACTAA-3′ and reverse 5′-TTCAAACTTTGAGGCTAACAGC-3′; and GAPDH, forward 5′-AAGAAGGTGGTGAAGCAGGC-3′ and reverse 5′-TCCACCACCCAGTTGCTGTA-3′. qPCR was performed using the Quantstudio3 platform (Applied Biosystems; Thermo Fisher Scientific, Inc.) with FS Universal SYBR Green Master (4913914001; Roche Diagnostics). The relative expression of the targets was determined by the 2^−∆∆Cq method in triplicate samples (22).

Total proteins were extracted using RIPA lysis buffer (Beyotime Institute of Biotechnology) supplemented with protease inhibitors (Roche Diagnostics). Protein concentrations were determined by a BCA protein assay kit (P0010; Beyotime Institute of Biotechnology). Proteins (40 µg per lane) were separated by SDS-PAGE and then transferred onto a polyvinylidene fluoride membrane. The membrane was blocked in TBST buffer containing 5% BSA for 2 h at room temperature, and then incubated with primary antibodies at 4°C overnight. The primary antibodies used in the study were as follows: CDK2 (1:1,000; ab32147; Abcam), CDK4 (1:2,000; ab199728; Abcam), cyclin A2 (1:2,000; ab181591; Abcam), cyclin D1 (1:2,000; ab134175; Abcam), GAPDH (1:1,000, TA-08; ZsBio). The membrane was then incubated with horseradish peroxidase (HRP)-goat anti-rabbit IgG (1:5,000; ZB-2301; ZsBio) or HRP-goat anti-mouse IgG (1:5,000; ZB-2305; ZsBio) after washing three times with TBST buffer. The blots were developed using the BeyoECL Plus kit (P0018S; Beyotime Institute of Biotechnology). The bands of target protein were subjected to densitometric analysis using Image-Pro Plus 6.0 software (Media Cybernetics).

A375 cells were seeded in 6-well plates and infected with sgCDK2-108 or sgCDK2-NC lentivirus. The cells were harvested by digesting with 0.25% trypsin and centrifuged at 1,000 × g at 4°C for 5 min, washed twice with PBS and centrifuged at 1,000 × g at 4°C for 5 min to remove the supernatant, then fixed with 70% ethanol at 4°C overnight. The cells were resuspended in PBS containing RNase A (100 µg/ml) at 37°C for 30 min, then stained with propidium iodide (WLA010a; Wanleibio) at 4°C for 30 min. The stained cells were analyzed using the BD Accuri C6 flow cytometer (BD Biosciences).

The A375 cells were handled as described above. The cells were resuspended in 500 µl binding buffer; subsequently, 5 µl Annexin V-Light 650 and 10 µl propidium iodide (WLA002c; Wanleibio) were added and gently mixed. The cells were stained at 37°C for 15 min and the apoptosis was determined using the BD Accuri C6 flow cytometer (BD Biosciences).

All data are expressed as the mean ± standard deviation of three independent experiments. The data were analyzed with Student's t-test between two groups, whereas multiple groups were analyzed with Student Newman Keuls (S-N-K) and one-way ANOVA using SPSS software, version 13.0 (SPSS, Inc.). P<0.05 was considered to indicate a statistically significant difference.

Fluorescence microscopy was used to investigate the infection efficiency of recombinant lentivirus in A375 cells. The results demonstrated that >80% of A375 cells expressed GFP among the sgCDK2-110, sgCDK2-108 and sgCDK2-NC groups (Fig. 1A). The qPCR results revealed that the mRNA levels of CDK2 were significantly downregulated in A375 cells infected by lentiviruses sgCDK2-110 and sgCDK2-108 compared with sgCDK2-NC (P<0.05; Fig. 1B). The results were further confirmed by western blotting, which demonstrated that the CDK2 was knocked out in A375 cells infected by lentiviruses sgCDK2-110 and sgCDK2-108, particularly sgCDK2-108 (P<0.05; Fig. 1C and 1D). These results indicated that CDK2 is depleted in A375 cells.

The effect of CDK2 knockout on the cell cycle in A375 cells was examined by flow cytometric analysis. The lentivirus sgCDK2-108 was selected for the following experiments. The results revealed an increased percentage of cells in the G0/G1 phase among A375 cells infected by lentivirus sgCDK2-108 (Fig. 2A). The percentage of cells in the G0/G1 phase among lentivirus sgCDK2-108-infected A375 cells was significantly higher (81.78%) compared with lentivirus sgCDK2-NC (69.06%); however, the percentage of S phase cells in the sgCDK2-108 group was significantly reduced (7.85%) compared with the sgCDK2-NC group (15.38%) (P<0.05; Fig. 2B). These results indicated that CDK2 knockout induces G0/G1 phase arrest in A375 cells.

Apoptosis was then analyzed in A375 cells infected with lentiviruses sgCDK2-108 or sgCDK2-NC. Compared with the sgCDK2-NC group, early apoptosis of A375 cells infected with lentivirus sgCDK2-108 was observed (Fig. 3A). The rate of early apoptosis in A375 cells infected with lentivirus sgCDK2-108 was 11.76%, and the rate of total apoptosis reached 12.47% (P<0.05; Fig. 3B), suggesting that knockout of CDK2 induces early apoptosis in A375 cells.

In order to investigate whether the cell cycle-related proteins were differentially regulated, the relative changes in CDK4, cyclin A2 and cyclin D1 expression were evaluated with RT-qPCR and western blot analysis. The results revealed that the transcriptional level of CDK4 was slightly downregulated (P>0.05), the level of cyclin A2 was significantly downregulated (P<0.05), whereas the level of cyclin D1 was significantly upregulated (P<0.05) (Fig. 4A). The protein levels of CDK4 and cyclin A2 were downregulated; in particular, cyclin A2 was significantly decreased. However, the protein expression of cyclin D1 was significantly upregulated (P<0.05) (Fig. 4B and 4C).