Guanmaitong (GMT) is a traditional Chinese herbal compound that has been used for the treatment of coronary heart disease (CHD) and other cardiovascular diseases. However, the efficacy of GMT in treating cardiovascular diseases remains unclear. The aim of the present study was to investigate the protective mechanisms and identify the targeted proteins and signaling networks associated with the physiological activity of GMT in a rat model of acute myocardial infarction (AMI). Sprague-Dawley rats were randomly allocated into five groups: Control group (sham-operated), the model group, and small, medium, and large dosage GMT groups. The rat model of AMI was established via ligation of the coronary artery. The results indicate that GMT was able to reduce myocardial infarction size and improve the activities of tumor necrosis factor-α (TNF-α), intercellular adhesion molecule 1 (ICAM-1) and interleukin-1. Furthermore, the reduced apoptotic index of the GMT-treated cardiocytes (P<0.05 vs. model group) was in accordance with the downregulated expression of Bax and the upregulated expression of Bcl-2. In conclusion, GMT may exert a protective potential against myocardial infarction injury by inhibiting apoptosis and inflammation of cardiomyocytes, and may offer a promising adjunct treatment for CHD.
Coronary heart disease (CHD), synonymously known as coronary artery disease (CAD) is the most predominant type of cardiovascular disease in developing countries (
Prior studies have reported the effects of various herb-derived compounds on clinical symptoms, biomarkers and mortality in AMI patients and animal models (
The use of a combination of multiple herbs is designed to exploit the additive or synergistic activities of individual herbs, as well as to balance or neutralize the toxic effects of certain herbal components by others in the mixture (
The aim of the present study was investigate the cardioprotective effects of GMT and to elucidate possible mechanisms underlying its effect on myocardial apoptosis and inflammatory response in rats with AMI.
A total of 60 healthy adult male Sprague-Dawley (SD) rats, aged 6–8 weeks and weighing 220–250 g, were provided by the Experimental Animal Center of PLA Academy of Military Medical Sciences (Beijing, China) and acclimated for at least three days [license no. SCXK (Army) 2007–004]. All animals were housed in separated cages with laboratory chow and tap water
SD rats were randomly allocated into five equal groups (n=12/group): Sham-operated control group (S), model group (M), and small (0.55 g/kg/day; GL), medium (1.1 g/kg/day; GM), and large (2.2 g/kg/day; GH) dosage GMT groups. GMT was provided by Tianjin Tongrentang Group Co., Ltd. (Tianjin, China). Control and model groups received an equal quantity of vehicle. After 14 days of treatment, animals underwent AMI surgery.
An AMI model was established in rats by ligation of the left anterior descending coronary artery for 24 h. The surgical procedure was performed according to a previous study (
A 2,3,5-triphenyltetrazolium chloride (TTC) assay was used to determine myocardial infarct size. TTC was provided by Amresco (Amresco LLC, Solon, OH, USA). In brief, the heart was transversely cut across the left ventricle, and sections 2–3 mm thick were incubated in 0.5% TTC solution prepared in phosphate buffer (pH 7.4; Sangon Biotech Co., Ltd., Shanghai, China) for 30 min at 37°C, following which they were fixed with 10% formalin (Sangon Biotech Co., Ltd.). Non-ischemic and viable ischemic myocardium were stained red, while the infarcted myocardium appeared pale grey or white. For histological analysis, 5-µm sections from the left ventricle were stained with hematoxylin and eosin (HE; Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd., Beijing, China). The pathological features were observed using a microscope (BX53; Olympus Corporation, Tokyo, Japan) at a magnification of ×400.
Abdominal aortic blood samples (4 ml) was separated by centrifugation at 840 ×
Rats were sacrificed with 10% chloral hydrate (2 ml/100 g) and total RNA was extracted from the rat heart tissues using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. RNA yields and purity were assessed by spectrophotometric analysis (BioPhotometer Plus; Eppendorf, Shanghai, China) at 260 and 280 nm. Total RNA (1 µg) from each well was subjected to reverse transcription with oligo dT (
ELISA measurements of IL-1 expression were performed in duplicate using a specific, commercially available IL-1 ELISA kit (Cusabio Biotech Co., Ltd., Wuhan, China) in accordance with the manufacturer's instructions, and analyzed using an ELISA reader (Tecan Trading AG, Männedorf, Switzerland) at 450 nm.
Myocardial tissue (100 mg) was grinded in liquid nitrogen and incubated with radioimmunoprecipitation assay lysis buffer, containing 20 mM HEPES, 0.5% NP-40 (both Sigma-Aldrich), 1% protease inhibitor cocktail (Promega Corporation), 200 mM KCl, 20% glycerol and 0.5 mM EDTA (all Sangon Biotech Co., Ltd.), to extract total protein. Subsequently, 30 µg protein/lane was subjected to 10% SDS-PAGE and transferred onto nitrocellulose membranes (EMD Millipore, Billerica, MA, USA). Membranes were blocked with 5% bovine serum albumin and subsequently incubated with antibodies against B-cell lymphoma 2 (Bcl-2; 1:1,000; 2876), Bcl-2-associated X protein (Bax; 1:1,000; 2772), TNF-α (1:2,000; MAB510) ICAM-1 (1:1,000; ab124760) and GAPDH (1:2,000; AB-M-M001), as the internal control, at 4°C overnight. Following washing six times for 30 min with Tris-buffered saline with Tween 20 (TBST), the membranes were incubated with horseradish peroxidase (HRP)-conjugated goat anti-rabbit IgG (7074) or horse anti-mouse IgG (7076) secondary antibodies (both 1:3,000; Cell Signaling Technology, Inc., Danvers, MA, USA) for 1 h at room temperature to detect the primary antibody. Following further washing with TBST for 30 min, the intensity of immunoreactive bands was estimated using an imaging densitometer (Gene Tools 3.06; Gene Company Ltd., Hong Kong). Rabbit polyclonal anti-Bax and anti-Bcl-2 antibodies were purchased from Cell Signaling Technology, Inc., monoclonal anti-TNF-α antibody from R&D Systems (Minneapolis, MN, USA), rabbit polyclonal anti-ICAM-1 antibody from Abcam (Cambridge, MA, USA) and anti-GAPDH antibody (1:2,000; AB-M-M001) from Hangzhou Xianzhi Biotechnology (Hangzhou, China).
Tissues were conventionally fixed with 10% formalin, then dehydrated with alcohol, embedded with paraffin wax and continuously sectioned at 5 µm. Sections were incubated overnight at 4°C with primary anti-Bcl-2 (BA0412) and anti-Bax (BA0315) antibodies (both 1:500; Wuhan Boster Biological Technology Ltd., Wuhan, China). Negative control were performed which involved the omission of primary antibody and use of phosphate-buffered saline (PBS). Sections were then rinsed with PBS and incubated for 1 h with HRP-conjugated secondary antibody (1:2,000; ZB2301; Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd.). The reaction was visualized using a solution of 3,3′-diaminobenzidine (Beijing Zhongshan Golden Bridge Biotechnology Co., Ltd.). For quantification, the integral optical density of Bax and Bcl-2 staining were calculated using Image-Pro Plus 6.0 software (Media Cybernetics, Inc., Rockville, MD, USA).
Data are reported as the mean ± standard deviation. Statistical significance was determined using one-way analysis of variance tests followed by Dunnett's test. Statistical analyses were performed using the software package StatView 5.0J (SAS Institute, Cary, NC, USA). P<0.05 was considered to indicate a statistically significant difference.
Representative illustrations of infarction tissue size (pale grey areas) as stained by TTC are shown in
Adult cardiomyocytes are post-mitotic cells, and thus have a limited response capability to damage (
At 24 h after AMI induction the mRNA expression levels of IL-1, TNF-α and ICAM-1 in the model group significantly increased (P<0.05 vs. sham group;
The western blot analysis results indicated that ICAM-1 expression increased in the model group (vs. sham group) and decreased significantly in the medium and high dosage GMT groups (P<0.05 vs. model group;
Apoptosis, the physiological process of programmed cell death, may contribute to various cardiac disorders (
AMI is currently speculated to involve the process of inflammation, which is a hallmark throughout the distinct stages of atherosclerosis and plaque rupture (
In the present study, the expression of a number of inflammatory cytokines increased rapidly in model group, while GMT treatment effectively reversed this change by influencing the expression of these factors and apoptosis regulators. Therefore, the present data support the cardioprotective capacity of GMT and suggest possible mechanisms underlying the observed anti-inflammatory and anti-apoptosis effects. Further mechanistic studies aimed at identifying the detailed signaling pathways upstream of TNF-α and Bcl-2 are required, in order to elucidate the molecular mechanisms underlying GMT and provide a theoretical basis for its clinical application.
This study was supported by grants from the Second Hospital of Tianjin Medical University (grant no. y1106) and Tianjin Tongrentang Group Co., Ltd. (Tianjin, China).
Myocardial infarct size and hematoxylin and eosin (HE) staining. (A) Normal myocardium is stained red, while pale grey areas indicate infarct areas. (B) HE staining was conducted to detect the pathological alterations (magnification, ×400). S, sham group; M, model group; GL, low dosage group; GM, medium dosage group; GH, high dosage group.
Effect of Guanmaitong (GMT) on cardiac marker enzyme activity in rats. Treatment with GMT attenuated the elevation of cardiac marker enzyme activity, and different dose groups of GMT decline to different extent. #P<0.05 vs. sham group; *P<0.05 vs. model group, as determined by one-way analysis of variance followed by Dunnett's test. M, model group; S, sham group; GL, low dosage group; GM, medium dosage group; GH, high dosage group; CK, creatine kinase; LDH, lactate dehydrogenase.
Expression of Bcl-2 and Bax in GMT-treated Sprague-Dawley rats with acute myocardial infarction. (A and B) Western Blot was used to evaluate the protein expression of Bcl-2 and Bax. (C) Immunohistochemical analysis was used to detected the expression of Bcl-2 and Bax (magnification, ×400). #P<0.05 vs. sham group; *P<0.05 vs. model group, as determined by one-way analysis of variance followed by Dunnett's test. S, sham group; M, model group; GL, low dosage group; GM, medium dosage group; GH, high dosage group; Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-associated X protein.
Detection of inflammation-related cytokine expression using reverse transcription-quantitative polymerase chain reaction. #P<0.05 vs. sham group; *P<0.05 vs. model group, as determined by one-way analysis of variance followed by Dunnett's test. M, model group; S, sham group; GL, low dosage group; GM, medium dosage group; GH, high dosage group; IL-1, interleukin-1; TNF-α, tumor necrosis factor-α; ICAM-1, intercellular adhesion molecule 1.
Detection of inflammation-related cytokine proteins in Guanmaitong-treated Sprague-Dawley rats with acute myocardial infarction. (A and B) Western blot was used to analyze the protein expression levels of ICAM-1 and TNF-α. (C) IL-1 expression was analyzed using an ELISA assay. #P<0.05 vs. sham group; *P<0.05 vs. model group, as determined by one-way analysis of variance followed by Dunnett's test. M, model group; S, sham group; GL, low dosage group; GM, medium dosage group; GH, high dosage group; ICAM-1, intercellular adhesion molecule 1; TNF-α, tumor necrosis factor-α; IL-1, interleukin-1.
Polymerase chain reaction primer sequences.
Gene | Sequence (5′-3′) |
---|---|
IL-1 | F, AAGACAAGCCTGTGTTGCTGAAGG |
R, TCCCAGAAGAAAATGAGGTCGGTC | |
TNF-α | F, AAATGGGCTCCCTCTCATCAGTTC |
R, TCTGCTTGGTGGTTTGGCTACGAC | |
ICAM-1 | F, GGGTTGGAGACTAACTGGA |
R, GCACCGCAGGATGAGGTTCTT | |
GAPDH | F, AACGACCCCTTCATTGACCT |
R, CCCCATTTGATGTTAGCGGG |
F, forward; R, reverse; IL-1, interleukin-1; TNF-α, tumor necrosis factor-α; ICAM-1, intercellular adhesion molecule 1.
Effect of Guanmaitong on myocardial infarct tissue size.
Group | Ventricle weight (g) | Infarction weight (g) | Infarction rate (%) |
---|---|---|---|
Model | 0.61±0.08 | 0.19±0.02 | 30.02±4.32 |
Sham | 0.57±0.06 | – | – |
Low dosage | 0.62±0.05 | 0.15±0.05 | 23.16±4.01 |
Medium dosage | 0.65±0.09 | 0.11±0.03 | 17.83±2.37 |
High dosage | 0.63±0.04 | 0.09±0.04 | 15.71±3.32 |
Data presented as the mean ± standard deviation.
P<0.05 vs. sham group
P<0.05 vs. model group.
Effect of Guanmaitong on cell apoptosis.
Group | Apoptosis index (%) | η (Bcl-2)% | η (Bax)% |
---|---|---|---|
Model | 31.8±1.9 |
13.1±1.3 |
52.7±2.0 |
Sham | 2.3±0.9 | 11.4±0.9 | 13.3±1.0 |
Low dosage | 25.1±2.1 |
15.3±1.0 | 49.5±5.1 |
Medium dosage | 23.2±1.6 |
18.6±1.8 |
45.1±2.7 |
High dosage | 18.5±5.1 |
21.7±2.2 |
34.4±3.3 |
η% indicates the positive area/total area.
P<0.05 vs. sham group
P<0.05 vs. model group, as determined by one-way analysis of variance followed by Dunnett's test. Bcl-2, B-cell lymphoma 2; Bax, Bcl-2-associated X protein.