The SMMC-7221, Huh7, MHCC-97L, HepG2, HepG3 and BEL-7402 human HCC cell lines, along with THLE-2 and THLE-3 normal human liver cell lines were obtained from the American Type Culture Collection (Manassas, VA, USA). Human HCC cells were grown in Williams’ medium E (#W1878; Sigma-Aldrich, Hong-Kong, China) supplemented with 10% fetal bovine serum (#10099-141; Gibco-BRL, Carlsbad, CA, USA) and antibiotics. The THLE-2 and THLE-3 cells were cultured in LHC-8 medium (#12678-017; Gibco-BRL) supplemented with 70 ng/ml phosphoethanolamine (#P0503; Sigma-Aldrich), 5 ng/ml epidermal growth factor (#E5036; Sigma-Aldrich), 10% fetal bovine serum and penicillin-streptomycin (10,000 U/ml, 10 ml/tube stored at −20°C; #15140-122; Gibco-BRL). All cells were cultured in a humidified atmosphere of 5% CO₂ in air at 37°C. 5-FU-resistant clone 1, clone 2 and pool cells were developed from HepG3 cells by treatment with gradually increasing concentrations of 5-FU (#F6627; Sigma-Aldrich) in cell culture medium. The resistant cells were re-selected every month through doxorubicin treatment.

Anti-HK II (rabbit monoclonal, #2867) and anti-β-actin (rabbit monoclonal, #4967) antibodies were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). Anti-5-FU antibodies were provided by Sigma-Aldrich.

Cells were seeded in 12-well plates at 1×10⁵ to 3×10⁵ cells per well. The culture media was collected at 48 h and stored at −20°C. Glucose uptake was measured using an Amplex Red Glucose/Glucose Oxidase assay kit (Molecular Probes, Camarillo, CA, USA). Absorbance was measured at 563 nm using a SpectraMax M5 plate reader (Molecular Devices, Sunnyvale, CA, USA) and the results were normalized to the quantity of total glucose compared with that of the control cells.

Lactate production in the medium was detected by using a Lactate assay kit (BioVision, Mountain View, CA, USA). The results were normalized to the quantity of total lactate compared with the control cells.

miRNA precursors (pre-miRNAs) and miRNA antisense RNAs (anti-miRNAs) were purchased from Applied Biosystems China (Beijing, China). Pre-miR-negative (#AM17110; Ambion, Austin, TX, USA) served as negative controls. Lipofectamine 2000 (Invitrogen Life Technologies, Carlsbad, CA, USA) was used for the pre-miRNAs or anti-miRNA transfections. At 48 h after transfection, the expression levels of miR-125b were detected by quantitative polymerase chain reaction and the expression levels of HK II, a target of miR-125b, were analyzed by western blot analysis.

Transfection was performed using Lipofectamine 2000 transfection reagent (Invitrogen Life Technologies) according to the manufacturer’s instructions. Overexpression vector containing wild-type HK II (Myc-DDK-tagged; RC209482) was purchased from Origene Technologies, Inc. (Rockville, MD, USA). At 48 h following transfection, the cells were collected for further analysis, and an aliquot was used to prepare whole-cell lysates.

HepG3 cells were treated with gradually increasing concentrations of 5-FU under regular cell culture conditions for the selection of resistant cells. Following successive treatments for up to two months, several resistant cell clones were developed from the parental cell line. 5-FU-resistant clone 1, clone 2 and pooled clones were used for subsequent experiments. The resistant cells were selected by 5-FU treatments each month.

RNA was isolated from cultured cells using an RNeasy mini-kit (Qiagen, Hilden, Germany) with an on-column DNAse digestion step according to the manufacturer’s instructions. Briefly, the lysates of the cells were passed through a Qiashredder (Qiagen) and the eluted lysates were mixed 1:1 with 70% ethanol. The lysates were applied to a mini-column and subsequent to washing and DNAse I digestion, the RNAs were eluted in 30–50 μl RNAse-free water. The quantity and quality of total RNA samples was checked by agarose-gel-electrophoresis and a Bioanalyzer RNA 6000 Nano assay (Agilent, Waldbronn, Germany). For miRNA expression analysis, RT-PCR was performed using a TaqMan microRNA reverse transcription kit (Applied Biosystems, China) and TaqMan microRNA assays kit (Applied Biosystems) following the manufacturer’s instructions. The precursor miR-125b RT primer used was: GTCGTATCCAGTGCAGGGTCCGAG GTATTCGCACTGGATACGACAGCACG. RNU6B (RT primer, TCGTATCCAGTGCAGGGTCCGAGGTATTCG CACTGGATACGACAAAATATGGAAC; Invitrogen Life Technologies) served as an internal control. All reactions were performed in triplicate. End-point PCR was conducted to analyze the expression levels of miR-125b using a mirVana RT-PCR miRNA detection kit and mirVana RT-PCR Primer sets (#AM1558; Applied Biosystems China) according to the manufacturer’s instructions. Human U6 (Invitrogen Life Technologies)served as an internal control. All reactions were performed in triplicate. The relative quantities of mRNA were calculated using the comparative CT method.

The pMIR-reporter luciferase vector containing either the wild-type HK II 3′-UTR or the binding site mutant HK II 3′-UTR and the empty vector were constructed according to methods previously described (29). For the luciferase assay, cells were seeded at a density of 2×10⁵ per well in 24-well plates and co-transfected with pMIR-REPORT luciferase reporters (#AM5795; Ambion) with the 3′-UTRs of wild-type HK II or binding site mutant HK II, and pre-miR-125b or pre-miR-negative using Lipofectamine 2000 reagent. After 48 h, the cells were harvested and lysed with passive lysis buffer (Promega Corporation, Madison, WI, USA). Luciferase activity was measured using a dual luciferase reporter assay (Promega Corporation). The pRL-TK vector (Promega Corporation) served as an internal control. The results were expressed as relative luciferase activity (firefly luciferase/renilla luciferase).

The cancer cells were treated with 5-FU at the indicated concentrations for 48 h. The cells were seeded in a 48-well plate, at a density of 1×10⁴ cells/well in 0.2 ml Williams’ medium E or LHC-8 medium containing 10% fetal bovine serum. Following overnight incubation under the same cultivating conditions, each well was refreshed with serum-free medium (SFM) for another day. The cells were then treated with SFM containing various concentrations of 5-FU. The drug-containing SFM was refreshed after two days and incubated under the same conditions. Cell viability was accessed by MTT (Sigma Diagnostics, Inc., St. Louis, MO, USA) staining for 1 h followed by the addition of DMSO and by measuring the absorbance at 590 nm with a SpectraMax Plus384 plate reader (Molecular Devices). The relative viability was obtained from the absorbance at 590 nm of drug-treated cells/the absorbance at 590 nm of untreated cells. The same experiment was repeated three times.

The cells were harvested and lysed in a buffer containing 50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 2 mM EDTA, 1% Triton, 1 mM phenylmethanesulfonyl fluoride and protease inhibitor cocktail (Sigma Diagnostics, Inc.) for 20 min on ice. The lysates were cleared by centrifugation at 10,000 × g at 4°C for 10 min. The supernatants were collected and protein concentrations were determined by the Bradford assay (Bio-Rad, Hercules, CA, USA). The proteins were then separated by SDS-PAGE and transferred to a nitrocellulose membrane (Bio-Rad). Subsequent to blocking with 5% non-fat dry milk in phosphate-buffered saline (PBS) for 1 h, the membranes were incubated overnight at 4–8°C with the primary antibodies in PBS with 5% non-fat dry milk. The membranes were extensively washed with PBS and incubated with horseradish peroxidase-conjugated secondary anti-mouse antibody or anti-rabbit antibody (1:2,000; Bio-Rad). Following additional washes with PBS, the antigen-antibody complexes were visualized with an enhanced chemiluminescence kit (Pierce Biotechnology, Inc., Rockford, IL, USA). The LAS-3000 Imaging system (Fuji, Tokyo, Japan) was used for the membrane exposure.

Statistical evaluation for data analysis was determined by unpaired Student’s t-test and GraphPad Prism software, version 5.0 (GraphPad Software, Inc., La Jolla, CA, USA) was used. All data are shown as the means. P<0.05 was considered to indicate a statistically significant difference.

miR-125b has been reported to act as a tumor suppressor in multiple tumors. In the present study, the expression levels of miR-125b in multiple types of human HCC cells were compared with those in normal human hepatocyte cells. A significant reduction in the expression levels of miR-125b was observed in the HCC cell lines compared with the normal hepatocytes (Fig. 1A), suggesting that miR-125b may be a tumor suppressor in human liver cancer cells. The observation that miR-125b was downregulated in liver cancer cells prompted investigation into the detailed functions of miR-125b through transient transfection of miR-125b into two liver cancer cell lines, HepG3 and Huh7 (Fig. 1B). The cell growth rates were significantly reduced in miR-125b-overexpressing liver cancer cells (Fig. 1C), suggesting that miR-125b acts as a tumor suppressor in human HCC cells.

As discussed above, chemotherapy resistance is a major obstacle that limits the effectiveness of clinical management of liver cancer. The dysregulated expression of tumor suppressor genes negatively correlates with chemoresistance of cancer cells. To investigate the function of miR-125b in liver cancer cell chemosensitivity, a 5-FU-resistant cancer cell line was generated using HepG3 cells by gradually treating the cells with elevated concentrations of 5-FU. Two HepG3 5-FU-resistant colonies were selected and the remainder were combined as a 5-FU-resistant pool. Fig. 2A shows that the resistant cells were significantly less sensitive to regular 5-FU treatments compared with the parental cells. The parental cells exhibited a IC₅₀ at ~10 μM, while the viability of 5-FU-resistant cells at 10 μM was significantly higher (P<0.05; Fig. 2A). The expression levels of miR-125b were measured in the 5-FU-resistant clone1, clone2 and pool cells. The results revealed that miR-125b was significantly downregulated in all 5-FU-resistant clones (Fig. 2B), suggesting that miR-125b functions as a tumor suppressor in liver cancer cells.

In accordance with the Warburg effect, evidence supports the hypothesis that dysregulated cellular metabolism is associated with drug resistance in cancer therapy. To analyze the putative mechanisms for miR-125b-mediated sensitization to chemotherapy in HCC cells, the glucose metabolism in 5-FU-resistant and -sensitive cells was measured in the present study. Notably, glucose metabolism, which is normally upregulated in chemoresistant cancer cells, was markedly increased in 5-FU-resistant cells. Lactate production (P<0.05; Fig. 3A) and glucose uptake (P<0.05; Fig. 3B) were significantly increased in 5-FU-resistant cells, indicating that dysregulated metabolism may contribute to chemoresistance.

To further elucidate the mechanism for miR-125b-mediated sensitization to 5-FU in liver cancer cells, potential targets of miR-125b were investigated by searching miRNA databases. The three public miRNA databases (TargetScan, Pictar and MicroRNA) all predicted HK II to be a target of miR-125b; the 3′-UTR of HK II contains a highly conserved binding site for miR-125b (Fig. 4A). HKs catalyze the first committed step in glucose metabolism and are important in tumor initiation and maintenance. Thus far, to the best of our knowledge, no publication has reported HK II to be a direct target of miR-125b in HCC cells. To determine whether miR-125b affects HK II in chondrosarcoma cells, pre-miR-125b and anti-miR-125b were transfected into HepG3 cells. The overexpression of miR-125b markedly downregulated HK II protein expression levels in comparison with a control group, but inhibition of miR-125b restored HK II expression levels in HepG3 cells. (Fig. 4B). To identify whether miR-125b directly targets the 3′-UTR of HK II mRNA, luciferase reporter analysis was performed by co-transfecting the cells with a vector containing pMIR reporter-luciferase fused with the original sequence or a predicted binding site mutant of the 3′-UTR of HK II mRNA, and pre-miR-100 or control microRNA. Overexpression of miR-125b significantly reduced the luciferase activity of the reporter with wild-type HK II 3′-UTR by ~60% in HepG3 cells (P<0.01; Fig. 4C). No inhibitory effects of miR-125b on the activity of the reporter with binding site mutant HK II 3′-UTR were detected (Fig. 4C). In conclusion, these results demonstrated that HK II is a direct target of miR-125b in HCC cells.

The above results revealed that HK II is a direct target of miR-125b. HK II has been established as essential in catalyzing the first committed step in glucose metabolism. To identify whether miR-125b regulates glucose metabolism in liver cancer cells, glucose uptake and lactate production in miR-125b-overexpressing HepG3 cells were compared with those in cells transfected with control microRNA. The data revealed significant inhibitions of glucose uptake and lactate production in the miR-125b-overexpressing cells (P<0.05; Fig. 5A and B), indicating that miR-125b may sensitize liver cancer cells to 5-FU through downregulation of glucose metabolism. In conclusion, the results in Figs. 3 and 5 revealed a correlation between miR-125b-mediated suppression of glucose metabolism and 5-FU sensitivity.

To determine the mechanisms accounting for miR-125b-mediated 5-FU sensitivity, miR-125b and control microRNA were transfected into HepG3 5-FU-sensitive and -resistant cells, and the cells were then treated with the indicated concentrations of 5-FU for 48 h. The effect of miR-125b overexpression on cell viability was examined following 5-FU administration. Treatment with 5-FU resulted in a marginal inhibition of cell viability in the control 5-FU-sensitive and -resistant HepG3 cells (Fig. 6A and B). However, when miR-125b was overexpressed in 5-FU-sensitive and -resistant liver cancer cells, the susceptibility of the cells to 5-FU was significantly increased (Fig. 6A and B), suggesting that miR-125 is involved in the development of 5-FU resistance. To examine whether sensitization to 5-FU by miR-125b occurred through inhibition of the glucose metabolism, an overexpression vector containing wild-type HK II was transfected into miR-125 pre-transfected HepG3 cells. Exogenous overexpression of HK II in miR-125 pre-transfected cells restored the expression levels of HK II to non-transfection levels (Fig. 7A). The sensitivity of the transfected HepG3 cells to 5-FU was then measured (Fig. 7B). The results demonstrated that exogenous upregulation of the glucose metabolism by overexpression of HK II rendered miR-125b overexpressing HepG3 cells significantly more resistant to 5-FU in comparison to cells not transfected with HK II. In conclusion, the results suggested that the overexpression of miR-125b sensitized HCC cells to 5-FU through inhibition of HK II.