SW480 and HCT116 cells were obtained from American Type Culture Collection (ATCC; Manassas, VA, USA), and cultured in RPMI-1640 (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Inc.) at 37°C with 5% CO₂. Human intestinal epithelial cells (IECs) were purchased from ATCC and cultured in Dulbecco's modified Eagle's medium (Gibco; Thermo Fisher Scientific, Inc.) containing 10% FBS at 37°C with 5% CO₂. GA was obtained from Sigma-Aldrich (St. Louis, MO, USA); 5-FU was purchased from Shanghai Xudong Haipu Pharmaceutical Co., Ltd. (Shanghai, China; H31020593). Cell counting kit-8 (CCK-8; C0037) was obtained from Beyotime Institute of Biotechnology (Haimen, China). Alexa Fluor^®488 Annexin V/Dead Cell Apoptosis kit (V13245) was from Invitrogen (Thermo Fisher Scientific, Inc.). The antibodies against P53 (ab131442; rabbit polyclonal, 53 kDa), survivin (ab24479; rabbit monoclonal, 16 kDa), thymidylate synthase (ab3145; mouse monoclonal, 35 kDa) and β-actin (ab6276; mouse monoclonal, 42 kDa) were from Abcam (Cambridge, MA, USA).

SW480 or HCT116 cells, or IECs (4×10⁴ cells/ml) were seeded in 96-well plates and cultured overnight. Solutions (100 µl) containing different concentrations of GA (0, 0.25, 0.5, 0.75, 1, 1.5, 2 and 3 µM), 5-FU (0, 6.25, 12.5, 25, 50, 100 and 200 µM) or 5-FU+GA were added for 48 h. Afterwards, 10 µl CCK-8 solution was added to each well, and the absorbance at 450 nm was read using a microplate reader (iMark; Bio-Rad Laboratories, Inc., Hercules, CA, USA) after 2 h of incubation. All assays were carried out in triplicate.

The interactions of the two drugs were evaluated by the median-effect principle, using the combination index (CI) method (30). CI values of 5-FU and GA were calculated using CompuSyn (USA) software (ComboSyn, Inc., Paramus, NJ, USA) where CI<1, CI=1 and CI>1 indicate synergism, addition and antagonism, respectively.

SW480 or HCT116 cells were cultured in 25-cm² flasks to approximately ~80% confluency, and 5-FU (SW480, 122.14 µM; HCT116, 18.43 µM), GA (SW480, 0.75 µM; HCT116, 1 µM) and 5-FU+GA, respectively, were added for 48 h. After three washes, cells were assessed using an inverted optical microscope.

Cells were harvested after 48 h incubation with GA, 5-FU or 5-FU+GA, and resuspended in Annexin-binding buffer to 2×10⁶ cells/ml. Annexin V and propidium iodide (PI) working solutions were added and the cells were incubated at room temperature for 15 min. Flow cytometry was performed (BD Biosciences, Franklin Lakes, NJ, USA), and data were analyzed using FlowJo 7.6 software (FlowJo, LLC, Ashland, OR, USA). All assays were run in triplicate.

Total RNA was extracted from the cells using Tripure isolation reagent (Roche Applied Science, Basel, Switzerland), and RNA samples were treated with DNase (Ambion; Thermo Fisher Scientific, Inc.). cDNA was synthesized from the obtained RNA samples using the Primescript 1st strand cDNA Synthesis kit (6110A; Takara Bio, Inc., Otsu, Japan) according to the manufacturer's protocol. Primers were designed using Primer Premier 6.0 software (Premier Biosoft, Palo Alto, CA, USA) and synthesized by Guangzhou Dahui Biotech Co., Ltd. (Guangzhou, China), with the following sequences (5′ to 3′): Glyceraldehyde 3-phosphate dehydrogenase (GAPDH; amplicon size, 164 bp), forward: TCCACTGGCGTCTTCACCACCAT and reverse: GGAGGCATTGCTGATGATCTTGAGG; P53 (amplicon size, 101 bp), forward: TGTTGGTCGGTGGGTTGGTAGT and reverse: GAGGTTGTCAGACAGGGTTTGGC; survivin (amplicon size, 133 bp), forward: AGCCCTTTCTCAAGGACCACCG and reverse: GCCAAGTCTGGCTCGTTCTCAG; TS (amplicon size, 101 bp), forward: CCATGCCCTCTGCCAGTTCTATG and reverse: TGGCGATGTTGAAAGGCACACC. qPCR was carried out using a SYBR Green Realtime PCR Master Mix kit [E090; Novo Protein Scientific (Shanghai), Inc., Shanghai, China] with a reaction mixture containing 2 µl cDNA, 0.25 µl each primer and 10 µl SYBR Green at 95°C (5 min) followed by 45 cycles of 95°C (10 sec) and 60°C (30 sec). All assays were run in triplicate. CT values were assessed using IQ5 software (Bio-Rad Laboratories, Inc.). Relative expression of target genes was determined using the 2^−ΔΔCq method (31).

Total protein was extracted from the cells with SDS-PAGE protein sample buffer (Beyotime Institute of Biotechnology, Haimen, China), resolved by SDS-PAGE (concentration gel, 5%; separation gel, 10%) and transferred onto polyvinylidene fluoride membranes. After blocking with 5% non-fat milk, membranes were incubated with anti-P53 (1:1,000), anti-survivin (1:1,000), anti-TS (1:100) and anti-β-actin (1:5,000) antibodies at 4°C overnight. This was followed by incubation with goat anti-rabbit antibody (1:10,000; SA00001-2;) or goat anti-mouse antibody (1:10,000; SA00001-1; both Wuhan Sanying, Biotechnology, Wuhan, China) at room temperature for 1 h. Signals were visualized with the SuperSignal West PICO chemiluminescent detection system (Pierce; Thermo Fisher Scientific, Inc.). Protein bands were detected using Quantity One version 4.62 software (Bio-Rad Laboratories, Inc.) and relative protein levels were calculated based on β-actin protein. All assays were run in triplicate.

Data are presented as the mean ± standard deviation. Comparisons were performed by one-way analysis of variance using SPSS version 21.0 software (IBM SPSS, Armonk, NY, USA). P<0.05 was considered to indicate a statistically significant difference.

As shown in Fig. 1A, GA at 0.25, 0.5 and 0.75 µM did not inhibit the proliferation of SW480 cells, and at 0.25, 0.5, 0.75 and 1 µM did not inhibit the proliferation of HCT116 cells (P>0.05). However, GA at higher concentrations inhibited cell growth in a concentration-dependent manner (P<0.05). To avoid the inhibitory effects of GA, non-inhibitory GA concentrations were selected for further combination experiments, that is, 0.25, 0.5 and 0.75 µM for SW480 cells and 0.25, 0.5, 0.75 and 1 µM for HCT116 cells.

Notably, 5-FU+GA exhibited a more pronounced inhibitory effect compared with 5-FU monotherapy (Fig. 1B and C). The inhibitory effects increased as the GA concentration in the combination increased, indicating that GA enhanced 5-FU-induced inhibition in a concentration-dependent manner (P<0.05).

All CI values were <1 for treatment with 5-FU (6.25, 12.5, 25, 50, 100 and 200 µM) combined with GA (0.25, 0.5 and 0.75 µM for SW480 cells; 0.25, 0.5, 0.75 and 1 µM for HCT116 cells) at 48 h, suggesting that the two drugs in these concentrations function synergistically (Fig. 1D).

Based on the above data, the 50% cell growth inhibitory concentrations (IC₅₀ values) of 5-FU were calculated (Fig. 1E). The IC₅₀ decreased with increasing concentration of GA in the combination, which directly demonstrated that GA enhanced the sensitivity to 5-FU of SW480 and HCT116 cells, in a concentration-dependent manner.

As GA was able to potentiate 5-FU cytotoxicity in cancer cells, whether 5-FU+GA affects normal cells in a similar manner was further investigated. As shown in Fig. 1F, no significant increase in cytotoxicity was observed. Instead, GA decreased the cytotoxicity of 5-FU in IECs (P<0.05).

To further explore these effects of 5-FU+GA, maximum non-inhibitory GA concentrations were selected in subsequent experiments, that is, 0.75 µM for SW480 cells and 1 µM for HCT116 cells. IC₅₀ values were selected as the 5-FU concentrations, that is, 122.14 and 18.43 µM for SW480 and HCT116 cells, respectively.

SW480 and HCT116 cells in the control group were adherent, with clear bar-shaped outlines, and good refraction. Following treatment with GA for 48 h, cell numbers decreased and cell gaps widened. In the 5-FU group, cell numbers decreased greatly; cells became round with shrunken bodies and obscure outlines. The effects were more pronounced in the combination group (Fig. 2).

Apoptosis rates were increased in SW480 and HCT116 cells treated with 5-FU alone for 48 h compared with the respective control values (P<0.05); the combination yielded stronger effects compared with 5-FU or GA alone (P<0.05). These findings indicate that the synergistic inhibition of 5-FU+GA partly resulted from increased apoptosis (Fig. 3).

To further explore the synergistic effects of 5-FU and GA, P53, survivin and TS mRNA expression levels were examined. 5-FU alone decreased P53, survivin and TS mRNA levels in SW480 cells compared with those in the control group; it also decreased P53 and TS mRNA levels in HCT116 cells (P<0.01). GA alone decreased survivin mRNA levels in SW480 cells and decreased P53, survivin and TS mRNA levels in HCT116 cells (P<0.05). The effects of the combination were more pronounced in both SW480 and HCT116 cells compared with the effects of 5-FU or GA alone (P<0.05; Fig. 4).

Compared with control group levels, 5-FU alone decreased P53, survivin and TS protein levels in SW480 cells, whereas in HCT116 cells 5-FU alone increased P53 protein levels and decreased survivin protein levels (P<0.01). GA alone decreased survivin and TS protein levels in SW480 cells (P<0.05); GA alone increased P53 protein levels and decreased survivin protein levels in HCT116 cells (P<0.01).

In comparison with 5-FU or GA alone, 5-FU+GA further decreased P53, survivin and TS protein levels in SW480 cells, and further decreased survivin and TS protein levels in HCT116 cells (P<0.01). P53 protein levels in HCT116 cells were increased to a greater extent by 5-FU+GA than by either 5-FU or GA alone (P<0.01; Fig. 5).