Contributed equally
Chemotherapy using 5-fluorouracil (5-FU) for colorectal cancer (CRC) has low specificity and response rates, leading to severe side effects. Gambogic acid (GA), a traditional Chinese medicine, has multi-targeted anticancer effects, including growth inhibition and apoptosis induction. However, it is unclear whether a combination of 5-FU and GA has synergistic anticancer effects in CRC cells. In this study, SW480 and HCT116 human CRC cells and human intestinal epithelial cells (IECs) were treated with different concentrations of 5-FU, GA or 5-FU+GA. A Cell Counting kit-8 assay was conducted to quantify cell proliferation. The combination index (CI) was calculated and the median-effect principle was applied to analyze the interaction between 5-FU and GA. Flow cytometry was used to determine the percentage of cells undergoing apoptosis. Reverse transcription-quantitative polymerase chain reaction and western blotting were applied to measure P53, survivin and thymidylate synthase (TS) mRNA and protein levels. It was found that 5-FU+GA more pronouncedly inhibited cell growth and induced apoptosis, compared with either monotherapy. CI values <1 indicated the synergistic effects of the drugs. 5-FU+GA further decreased P53, survivin and TS mRNA and protein levels in the two CRC cell lines compared with single drugs, whereas increased P53 protein levels were observed in HCT116 cells. Moreover, 5-FU+GA did not increase cytotoxicity to IECs. These results demonstrate that GA enhances the anticancer effects of 5-FU on CRC cells. Combined treatment with 5-FU and GA is effective and safe for CRC cells, and may become a promising chemotherapy treatment.
Colorectal cancer (CRC) is one of the most commonly diagnosed malignancies and a leading cause of cancer-related mortality worldwide (
Treatment options for CRC include surgery, chemotherapy and radiotherapy. Surgical resection is the main and most effective option (
5-Fluorouracil (5-FU)-based chemotherapeutics are commonly used in CRC (
Therefore, the development of novel chemotherapy strategies is essential. Several studies (
Gambogic acid (GA), a common traditional Chinese medicine and the main active component of
P53 is a key tumor suppressor (
So far, to the best of our knowledge, whether GA enhances 5-FU chemotherapy in CRC has not been investigated. In the present study, the effects of 5-FU combined with GA were evaluated in two CRC cell lines, and the effects of the combination on the regulation of P53, survivin and TS, apoptosis and chemoresistance-related genes were explored.
SW480 and HCT116 cells were obtained from American Type Culture Collection (ATCC; Manassas, VA, USA), and cultured in RPMI-1640 (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Thermo Fisher Scientific, Inc.) at 37°C with 5% CO2. Human intestinal epithelial cells (IECs) were purchased from ATCC and cultured in Dulbecco's modified Eagle's medium (Gibco; Thermo Fisher Scientific, Inc.) containing 10% FBS at 37°C with 5% CO2. GA was obtained from Sigma-Aldrich (St. Louis, MO, USA); 5-FU was purchased from Shanghai Xudong Haipu Pharmaceutical Co., Ltd. (Shanghai, China; H31020593). Cell counting kit-8 (CCK-8; C0037) was obtained from Beyotime Institute of Biotechnology (Haimen, China). Alexa Fluor®488 Annexin V/Dead Cell Apoptosis kit (V13245) was from Invitrogen (Thermo Fisher Scientific, Inc.). The antibodies against P53 (ab131442; rabbit polyclonal, 53 kDa), survivin (ab24479; rabbit monoclonal, 16 kDa), thymidylate synthase (ab3145; mouse monoclonal, 35 kDa) and β-actin (ab6276; mouse monoclonal, 42 kDa) were from Abcam (Cambridge, MA, USA).
SW480 or HCT116 cells, or IECs (4×104 cells/ml) were seeded in 96-well plates and cultured overnight. Solutions (100 µl) containing different concentrations of GA (0, 0.25, 0.5, 0.75, 1, 1.5, 2 and 3 µM), 5-FU (0, 6.25, 12.5, 25, 50, 100 and 200 µM) or 5-FU+GA were added for 48 h. Afterwards, 10 µl CCK-8 solution was added to each well, and the absorbance at 450 nm was read using a microplate reader (iMark; Bio-Rad Laboratories, Inc., Hercules, CA, USA) after 2 h of incubation. All assays were carried out in triplicate.
The interactions of the two drugs were evaluated by the median-effect principle, using the combination index (CI) method (
SW480 or HCT116 cells were cultured in 25-cm2 flasks to approximately ~80% confluency, and 5-FU (SW480, 122.14 µM; HCT116, 18.43 µM), GA (SW480, 0.75 µM; HCT116, 1 µM) and 5-FU+GA, respectively, were added for 48 h. After three washes, cells were assessed using an inverted optical microscope.
Cells were harvested after 48 h incubation with GA, 5-FU or 5-FU+GA, and resuspended in Annexin-binding buffer to 2×106 cells/ml. Annexin V and propidium iodide (PI) working solutions were added and the cells were incubated at room temperature for 15 min. Flow cytometry was performed (BD Biosciences, Franklin Lakes, NJ, USA), and data were analyzed using FlowJo 7.6 software (FlowJo, LLC, Ashland, OR, USA). All assays were run in triplicate.
Total RNA was extracted from the cells using Tripure isolation reagent (Roche Applied Science, Basel, Switzerland), and RNA samples were treated with DNase (Ambion; Thermo Fisher Scientific, Inc.). cDNA was synthesized from the obtained RNA samples using the Primescript 1st strand cDNA Synthesis kit (6110A; Takara Bio, Inc., Otsu, Japan) according to the manufacturer's protocol. Primers were designed using Primer Premier 6.0 software (Premier Biosoft, Palo Alto, CA, USA) and synthesized by Guangzhou Dahui Biotech Co., Ltd. (Guangzhou, China), with the following sequences (5′ to 3′): Glyceraldehyde 3-phosphate dehydrogenase (GAPDH; amplicon size, 164 bp), forward: TCCACTGGCGTCTTCACCACCAT and reverse: GGAGGCATTGCTGATGATCTTGAGG; P53 (amplicon size, 101 bp), forward: TGTTGGTCGGTGGGTTGGTAGT and reverse: GAGGTTGTCAGACAGGGTTTGGC; survivin (amplicon size, 133 bp), forward: AGCCCTTTCTCAAGGACCACCG and reverse: GCCAAGTCTGGCTCGTTCTCAG; TS (amplicon size, 101 bp), forward: CCATGCCCTCTGCCAGTTCTATG and reverse: TGGCGATGTTGAAAGGCACACC. qPCR was carried out using a SYBR Green Realtime PCR Master Mix kit [E090; Novo Protein Scientific (Shanghai), Inc., Shanghai, China] with a reaction mixture containing 2 µl cDNA, 0.25 µl each primer and 10 µl SYBR Green at 95°C (5 min) followed by 45 cycles of 95°C (10 sec) and 60°C (30 sec). All assays were run in triplicate. CT values were assessed using IQ5 software (Bio-Rad Laboratories, Inc.). Relative expression of target genes was determined using the 2−ΔΔCq method (
Total protein was extracted from the cells with SDS-PAGE protein sample buffer (Beyotime Institute of Biotechnology, Haimen, China), resolved by SDS-PAGE (concentration gel, 5%; separation gel, 10%) and transferred onto polyvinylidene fluoride membranes. After blocking with 5% non-fat milk, membranes were incubated with anti-P53 (1:1,000), anti-survivin (1:1,000), anti-TS (1:100) and anti-β-actin (1:5,000) antibodies at 4°C overnight. This was followed by incubation with goat anti-rabbit antibody (1:10,000; SA00001-2;) or goat anti-mouse antibody (1:10,000; SA00001-1; both Wuhan Sanying, Biotechnology, Wuhan, China) at room temperature for 1 h. Signals were visualized with the SuperSignal West PICO chemiluminescent detection system (Pierce; Thermo Fisher Scientific, Inc.). Protein bands were detected using Quantity One version 4.62 software (Bio-Rad Laboratories, Inc.) and relative protein levels were calculated based on β-actin protein. All assays were run in triplicate.
Data are presented as the mean ± standard deviation. Comparisons were performed by one-way analysis of variance using SPSS version 21.0 software (IBM SPSS, Armonk, NY, USA). P<0.05 was considered to indicate a statistically significant difference.
As shown in
Notably, 5-FU+GA exhibited a more pronounced inhibitory effect compared with 5-FU monotherapy (
All CI values were <1 for treatment with 5-FU (6.25, 12.5, 25, 50, 100 and 200 µM) combined with GA (0.25, 0.5 and 0.75 µM for SW480 cells; 0.25, 0.5, 0.75 and 1 µM for HCT116 cells) at 48 h, suggesting that the two drugs in these concentrations function synergistically (
Based on the above data, the 50% cell growth inhibitory concentrations (IC50 values) of 5-FU were calculated (
As GA was able to potentiate 5-FU cytotoxicity in cancer cells, whether 5-FU+GA affects normal cells in a similar manner was further investigated. As shown in
To further explore these effects of 5-FU+GA, maximum non-inhibitory GA concentrations were selected in subsequent experiments, that is, 0.75 µM for SW480 cells and 1 µM for HCT116 cells. IC50 values were selected as the 5-FU concentrations, that is, 122.14 and 18.43 µM for SW480 and HCT116 cells, respectively.
SW480 and HCT116 cells in the control group were adherent, with clear bar-shaped outlines, and good refraction. Following treatment with GA for 48 h, cell numbers decreased and cell gaps widened. In the 5-FU group, cell numbers decreased greatly; cells became round with shrunken bodies and obscure outlines. The effects were more pronounced in the combination group (
Apoptosis rates were increased in SW480 and HCT116 cells treated with 5-FU alone for 48 h compared with the respective control values (P<0.05); the combination yielded stronger effects compared with 5-FU or GA alone (P<0.05). These findings indicate that the synergistic inhibition of 5-FU+GA partly resulted from increased apoptosis (
To further explore the synergistic effects of 5-FU and GA, P53, survivin and TS mRNA expression levels were examined. 5-FU alone decreased P53, survivin and TS mRNA levels in SW480 cells compared with those in the control group; it also decreased P53 and TS mRNA levels in HCT116 cells (P<0.01). GA alone decreased survivin mRNA levels in SW480 cells and decreased P53, survivin and TS mRNA levels in HCT116 cells (P<0.05). The effects of the combination were more pronounced in both SW480 and HCT116 cells compared with the effects of 5-FU or GA alone (P<0.05;
Compared with control group levels, 5-FU alone decreased P53, survivin and TS protein levels in SW480 cells, whereas in HCT116 cells 5-FU alone increased P53 protein levels and decreased survivin protein levels (P<0.01). GA alone decreased survivin and TS protein levels in SW480 cells (P<0.05); GA alone increased P53 protein levels and decreased survivin protein levels in HCT116 cells (P<0.01).
In comparison with 5-FU or GA alone, 5-FU+GA further decreased P53, survivin and TS protein levels in SW480 cells, and further decreased survivin and TS protein levels in HCT116 cells (P<0.01). P53 protein levels in HCT116 cells were increased to a greater extent by 5-FU+GA than by either 5-FU or GA alone (P<0.01;
GA is a novel anticancer drug whose mechanisms have not been fully explored. Wang
In the present study, it was found that GA potentiated the cytotoxicity of 5-FU to SW480 and HCT116 cells in a concentration-dependent manner. 5-FU and GA together had synergistic effects, and could further induce apoptosis. The synergism was also found in the regulation of P53, survivin and TS, at the gene and protein levels. Moreover, the combination of 5-FU and GA did not increase cytotoxicity to normal cells, indicating that the combination was not only effective, but also safe.
P53 is the most frequently mutated gene in human cancers (
The two CRC cell lines assessed in the present study have different P53 types: SW480 has mutant P53 (
The results of the present study showed that GA or 5-FU alone decreased SW480 mutant P53 mRNA and protein levels, and the combination resulted in more pronounced effects. In HCT116 cells, the combination of 5-FU and GA further increased wild-type P53 protein levels but decreased P53 mRNA expression. The decreased gene expression in HCT116 might be associated with negative-feedback inhibition.
P53 and survivin are both closely associated with apoptosis: Wild-type P53 induces apoptosis (
TS plays an important role in 5-FU metabolism and it is an important target of 5-FU chemotherapy (
High expression levels of survivin and TS are associated with chemoresistance (
Overall, these findings demonstrate that GA potentiates the chemosensitivity of CRC cells to 5-FU without increasing the cytotoxicity to normal cells. Thus, this combination might provide a promising treatment for patients with CRC. Future studies are essential to evaluate this combination in animal models and explore the underlying mechanisms.
This study was supported by a grant from the National Natural Science Foundation of China (grant no. 81272556). The authors thank MedSci (Shanghai, China) for English editing.
5-fluorouracil
colorectal cancer
gambogic acid
combination index
thymidylate synthase
intestinal epithelial cell
Effects of 5-FU combined with GA. (A) Inhibitory effects of various GA concentrations on SW480 and HCT116 cells at 48 h. *P<0.05 vs. control (0 µM). (B and C) Combined effects of GA and 5-FU on (B) SW480 and (C) HCT116 cells. Cells were co-exposed to different concentrations of 5-FU and non-inhibitory concentrations of GA for 48 h. *P<0.05 and #P<0.01 vs. 5-FU alone. (D) Combination index (CI) plot for GA+5-FU treatment. The points below the line indicate CI<1. (E) IC50 values of 5-FU when combined with GA at different concentrations. (F) Cytotoxicity of 5-FU+GA on IECs at 48 h. *P<0.05 vs. 5-FU alone. All assays were run in triplicate. 5-FU, 5-fluorouracil; GA, gambogic acid; IC50, 50% cell growth inhibitory concentration; IEC, intestinal epithelial cell.
Morphological changes in cells treated with 5-FU, GA or 5-FU+GA. Cells were treated with GA (SW480, 0.75 µM; HCT116, 1 µM), 5-FU (SW480, 122.14 µM; HCT116, 18.43 µM) or GA+5-FU for 48 h. Untreated cells were used as controls. 5-FU, 5-fluorouracil; GA, gambogic acid.
Apoptosis in cells treated with 5-FU, GA or 5-FU+GA. Cells were treated with GA (SW480, 0.75 µM; HCT116, 1 µM), 5-FU (SW480, 122.14 µM; HCT116, 18.43 µM) or GA+5-FU for 48 h. Untreated cells were used as controls. aP<0.05 and bP<0.01 vs. the control. *P<0.05 and #P<0.01. All assays were run in triplicate. 5-FU, 5-fluorouracil; GA, gambogic acid; PE, phytoerythrin; PI, propidium iodide; FITC, fluorescein isothiocyanate.
Changes of P53, survivin and TS mRNA levels. Cells were treated with GA (SW480, 0.75 µM; HCT116, 1 µM), 5-FU (SW480, 122.14 µM; HCT116, 18.43 µM) or GA+5-FU for 48 h. Untreated cells were used as controls. aP<0.05 and bP<0.01 vs. the control. *P<0.05 and #P<0.01. All assays were run in triplicate. 5-FU, 5-fluorouracil; GA, gambogic acid.
Changes of P53, survivin and TS protein levels. Cells were treated with GA (SW480, 0.75 µM; HCT116, 1 µM), 5-FU (SW480, 122.14 µM; HCT116, 18.43 µM) or GA+5-FU for 48 h. Untreated cells were used as controls. aP<0.05 and bP<0.01 vs. the control. #P<0.01. All assays were run in triplicate. 5-FU, 5-fluorouracil; GA, gambogic acid.