Bone marrow was collected from the femur of five healthy female Shanghai white pigs (8–12 weeks old; Shanghai Jiagan Biological Technology Co., Ltd., Shanghai, China) with a 16-gauge needle containing 200 U/ml heparin (Sigma-Aldrich, St. Louis, MO, USA). The aspirates were depleted of mature blood lineages and purified by centrifugation in a 1.073-g/ml Percoll (Gibco, Grand Island, NY, USA) density gradient. Mononuclear cells were cultured in tissue culture flasks in low-glucose Dulbecco’s modified Eagle’s medium (LG-DMEM; Gibco) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT, USA), 100 U/ml penicillin and 100 μg/ml streptomycin (Gibco). Non-adherent cells were discarded after 48 h, and adherent cells were further expanded until confluent. Cells were passaged up to eight times. The morphology of isolated cells was observed under a microscope (DM2700M; Leica, Wetzlar, Germany). This study was approved by the Institutional Review Board and Institutional Animal Care and Use Committee of Fudan University (Shanghai, China).

Cells were stained with CD90, CD44, CD34 and CD45 (Ebioscience, San Diego, CA, USA), and then with an appropriate secondary antibody conjugated with FITC and Cy5 (Ebioscience). After washing with phosphate-buffered saline (PBS), flow cytometry was performed on a BD FACSCalibur (BD Biosciences, San Jose, CA, USA).

Cell proliferation was monitored by 3-(4, 5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. MSCs from passages 2, 5 and 8 were seeded onto 96-well plates (1×10⁴ cells/well), and cell proliferation was documented every 24 h for 12 days. The number of viable cells was assessed by measurement of the absorbance at 490 nm using a Safire 2 microplate reader (Tecan Systems Inc., San Jose, CA, USA).

MSCs from passages 2, 5 and 8 were prepared at a high concentration of 10⁶ cells/ml, and 10 μl cell suspension was mixed with 790 μl PBS and 200 μl trypan blue (20 g/l). The number of stained cells and the total number of cells were counted in a clean hemocytometer slide under a low-power microscope (DM2770M; Leica).

To demonstrate the single induction effect of 5-AZA (Sigma-Aldrich), MSCs from passages 2 and 5 were grown to 70–85% confluence and treated with 5-AZA (10 μmol/l) for 24 h. The morphological changes in MSCs from day 0 (prior to treatment) to day 21 were observed under a microscope (DM2700M; Leica).

cDNA encoding the IGF-1 gene was cloned and inserted into the pCDH-CMV-MCS-EF1-coGFP vector (GeneChem, Shanghai, China) at the EcoRI and XbaI sites. shRNA-IGF-1 was synthesized as follows: shRNA-IGF-1 sense, CCGGTGTTCAGG AAACAAG AACTACTCGAGTAGTTCTTGTTTCCTGAACTTTTTTG; and shRNA-IGF-1 antisense, AATTCA AAAAAGTTCAGGA AACAAGAACTACTCGAGTAGTTCTGTTTCCTGAACA. After annealing, the shRNA-IGF-1 fragment was cloned into the pLKO.1-TRC vector. The identities of recombinant plasmids pCDH-IGF-1-GFP and pLKO.1-shRNA-IGF-1 were confirmed by PCR and DNA sequencing.

Following construction, pCDH-IGF-1-GFP and pLKO.1-shRNA-IGF-1 were transfected into a packaging cell line (293T; American Type Culture Collection, Manassas, VA, USA) with package plasmids psPAX2 and pMD2.G (GeneChem) to produce a high-titer lentivirus. Concentrated viral supernatants were generated by ultracentrifugation and assessed by fluorescence-activated cell sorting (FACS) analysis for GFP on transduced control cells.

MSCs from passage 2 were divided into four groups as follows: i) MSC group: MSCs were untreated; ii) control group: MSCs were transfected with control lentivirus; iii) oeIGF-1 group: MSCs were transfected with lentivirus encoding IGF-1; and iv) siIGF-1 group: MSCs were transfected with lentivirus encoding shRNA-IGF-1.

Following gene manipulation, MSCs from all groups (MSC, control, oeIGF-1 and siIGF-1) were grown to 70–85% confluence and then treated with 5-AZA (10 μmol/l) for 24 h. The dual-phase treated MSCs were then cultured for 21 days.

One day after the combined induction, IGF-1 expression in all groups was verified by immunocytochemistry. Cells were fixed for 30 min with 4% formalin and rinsed with PBS. Following permeabilization with 0.4% Triton X-100 (Sigma-Aldrich) for 10 min, cells were blocked with 10% bovine serum albumin (Life Technologies, Grand Island, NY, USA) for 30 min prior to being incubated with goat anti-human polyclonal IGF-1 primary antibody (R&D, Santa Fe Springs, CA, USA) at 37°C for 2 h, followed by incubation in a 1:50 dilution of horseradish peroxidase-conjugated rabbit anti-goat IgG secondary antibody (R&D). Hematoxylin was used for nuclear counterstaining and the immunostained cells were visualized under a microscope (DM2700M; Leica).

On days 7, 14 and 21, IGF-1 expression and cardiomyocyte-specific markers (GATA-4, Nkx2.5, β-MHC and MEF2c) of the induced MSCs were identified by qPCR. Total RNA was isolated using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. cDNA was prepared from 1 mg total RNA using a cDNA synthesis kit (Promega, Madison, WI, USA). qPCR was carried out with SYBR supermix (Takara, Shiga, Japan). The primers used for amplification are listed in Table I. The expression of each target mRNA relative to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was calculated based on the threshold cycle (CT) as r=2^−Δ(ΔCT).

Cardiomyocyte-specific markers (GATA-4, Nkx2.5, β-MHC and MEF2c) of the induced MSCs were also identified with immunoblotting every week. Total protein was extracted from MSCs and differentiated cardiomyocyte-like cells, and then quantified with a BCA protein assay kit (Pierce, Rockford, IL, USA). Cell lysates were separated by SDS-PAGE (10%) and incubated with goat anti-pig polyclonal primary antibodies (anti-GAT4, -Nkx2.5, -β-MHC and -MEF2c; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) and donkey anti-goat IgG (R&D) secondary antibody conjugated with horseradish peroxidase. GAPDH was used as a loading control. Complexes were detected by chemiluminescence (Phototope-HRP Western Blot Detection System; Cell Signaling, Danvers, MA, USA).

Each experiment was conducted at least three times. Data are presented as the means ± standard deviation. One-way analysis of variance was used to determine statistical significance between groups. Data were analyzed with SPSS version 17.0 software (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

The morphology of isolated porcine MSCs (passage 2) is shown in Fig. 1A. During the first two days, the culture was heterogeneous, containing round and non-adherent cells with lipid micelles in the supernatant. After 10 days, the cell population became more homogeneous, presenting an adherent fibroblast-like shape, and began to form cell colonies.

To characterize the MSCs, we performed flow cytometric analysis with antibodies against CD90, CD44, CD34 and CD45. As shown in Fig. 1B, the majority of cells expressed CD90 and CD44 at moderate to high levels, while these cells were negative for CD34 and CD45 (surface markers for hematopoietic stem cells). MSCs could be passaged up to eight times and the proliferation rate and cell viability of MSCs varied among the different passages, as shown in Fig. 1C and D. MSCs in the second passage grew faster and exhibited higher viability than MSCs in the fifth or eighth passage (P<0.05). The growth curve for each group showed a similar ‘S’ shape. The first two days represented the latent phase, and the logarithmic growth phase was from day 3 to 6. Days 7 and 8 represented the plateau phase.

As shown in Fig. 2A, MSCs demonstrated a fibroblast-like morphology prior to 5-AZA treatment (0 weeks). Following 5-AZA treatment for 48 h, ~60% of the MSCs detached from the plate, and the morphology of the remaining cells gradually changed. The remaining 40% of the MSCs gradually increased in size, formed a ball-like appearance, or lengthened in one direction and formed a stick-like morphology at one week. As shown in Fig. 2B and C, the cells connected with adjoining cells after three weeks. MSCs in the second passage grew faster and exhibited a significantly higher cardiomyocyte-like induction ratio than those in the fifth passage (Table II).

IGF-1 expression in the oeIGF-1 group is shown in Fig. 3A. The combination of IGF-1 overexpression with 5-AZA treatment induced the cardiomyocyte-like differentiation of MSCs, which was demonstrated by the expression of specific cardiomyocyte markers (GATA-4, Nkx2.5, β-MHC and MEF2c). Compared with the MSC and control groups, the oeIGF-1 group expressed mRNA and protein of specific markers at a higher level on day 14 and day 21 following treatment with 5-AZA (P<0.05), but no significant difference was shown on day 7 (Fig. 3B and C).

IGF-1 expression in the siIGF-1 group is shown in Fig. 3A. The mRNA and protein expression of the siIGF-1 group was significantly downregulated for the majority of the specific cardiomyocyte markers (P<0.05) (Fig. 3B and C).