MTT, dimethyl sulfoxide (DMSO) and G418 were purchased from Sigma (St. Louis, MO, USA). The ELISA kit for HBsAg and HbeAg was obtained from the Sino-American Biotechnology Company (Luoyang, China). The HBV DNA extraction and amplification fluorescence assay kit was purchased from Guangzhou Da An Gene Co., Ltd. of Sun Yat-Sen University (Guangzhou, China). High-glucose Dulbecco’s modified Eagles medium (DMEM), trypsin, EDTA, L-glutamine and fetal bovine serum (FBS) were purchased from Gibco-BRL (Carlsbad, CA, USA). Lamivudine, also referred to as 2′-3′deoxy-3′-thiocytidine (3TC), was obtained from GlaxoSmithKline Pharmaceuticals Co., Ltd. (Brentford, UK) and freshly prepared before use.
The
Five fractions extracted from BNL [petroleum ether fraction (PEF), chloroform fraction (CF), ethyl acetate fraction (EAR), n-butanol fraction (nBF) and aqueous fraction (AF)]were dissolved in ethanol and their chemical compositions were assayed qualitatively, as described previously (
HepG2.2.15 cells transfected with human HBV DNA were provided by the Beijing No. 302 Hospital and maintained in DMEM supplemented with 10% FBS, 1% penicillin/streptomycin and 200 mg/l G418 in a humidified atmosphere of 5% CO2 at 37°C. For treatment, 1×104 cells were seeded in a 96-well plate and cultured for 24 h prior to extract addition. The extracts were dissolved in DMSO and diluted to proper concentrations. The medium was changed three times every 3 days using fresh medium containing the corresponding extracts. At different time points (3, 6 and 9 days), medium was collected and stored at −20°C until use. Under the same conditions, a blank group was used as the negative control and 3TC as the positive control.
In order to investigate the cytotoxic effects of the BNL extracts, the MTT assay was used. Briefly, the HepG2.2.15 cells were seeded in a 96-well plate and treated with the different extracts for 9 days. Following treatment, the medium was replaced with an equal volume of fresh medium containing 5 mg/ml MTT and the plate was incubated for 4 h at 37°C. The MTT was removed and the cells were lysed with DMSO. The dark blue formazan crystals formed in intact cells were solubilized by shaking for 15 min and the absorbance at 570 nm was measured with an Elx800 type ELISA analyzer microplate reader (BioTek Instruments, Inc., Winooski, VT, USA). The cell growth rate was expressed as a percentage of the control.
HBsAg and HBeAg in the conditioned medium were quantified using two antibody sandwich ELISA kits (Sino-American Biotechnology Company), according to the protocol provided by the manufacturer.
The amount of HBV DNA in the cultured medium was measured by QF-PCR. Total RNA was extracted from HepG2.2.15 cells treated with different concentrations of CF (12.5, 25, 50 and 100 mg/l), EAF (25, 50, 100 and 200 mg/l) and 3TC (positive control; 25, 50, 200 mg/l) for 3, 6 and 9 days, using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The primers used in this study were as follows: P1, 5 ‘ATCCTGCTGCTATGCCTCATCTT 3′; P2, 5′ ACAGTGGGGGAAAGCCCTACGAA 3′; fluorescent probe sequence, 5′ GGCTAGTTTACTAGTGCCATTTG 3′. The amplification parameters included predegeneration at 93°C for 2 min, followed by 10 cycles of denaturation at 93°C for 45 sec and annealing at 55°C for 1 min; the condition was then changed to 30 cycles of denaturation at 93°C for 30 sec and annealing at 55°C for 45 sec.
Data are presented as the means ± standard error of the mean and the Student’s t-test was applied for statistical analysis to determine the statistical significance. P<0.05 was considered to indicate a statistically significant difference.
To investigate the effects of the BNL extracts on HBsAg and HBeAg secretion by HepG2.2.15 cells, we first determined the inhibitory concentration 50 (IC50) of the different BNL extracts. As shown in
In order to determine the effects of CF and EAF on HBV DNA secretion by HepG2.2.15 cells, QF-PCR was performed. As shown in
To determine whether the anti-HBV effects of the BNL extracts were due to cytotoxicity, the effects of BNL extracts on HepG2.2.15 cell proliferation were assessed by the MTT assay. After 9 days of treatment, HepG2.2.15 cell growth was found to be unaffected by CF or EAF treatment (
In order to determine the chemical composition of the BNL extracts, a qualitative assay was performed as previously described (
It was previously reported that the
This study was supported in part by grants from the Traditional Medical Science and Technology Foundation from the Administration of Chinese Traditional Medicine of Guangxi Province (no. GZKZ-Z1107); the Open Fund of the Medical Scientific Research Center of Guangxi Medical University (nos. KFJJ2010-49 and KFJJ2011-06); the Lijiang Scholarship Foundation and the Science and Technology Planning Project of Guilin City (no. 20110119-1-8); the Natural Science Foundation of Guangxi Province (no. 2013GXNSFCA019012) and the National Natural Science Foundation of China (nos. 31370917 and 30972797). This study was also supported by a direct grant from the Guilin Medical University. The authors would like to thank Dr Junfei Jin for reviewing the manuscript.
hepatitis B virus
petroleum ether fraction
chloroform fraction
ethyl acetate fraction
n-butanol fraction
aqueous fraction
BNL extraction procedure. Dried BNL (7 kg) was extracted in a stepwise procedure. Finally, 27 g of petroleum ether, 35 g of chloroform, 25 g of ethyl acetate, 75 g of n-butanol and 34 g of aqueous extracts were harvested. BNL
Effects of CF and EAF on HBV DNA in the medium secreted by HepG2.2.15 cells. A total of 1×104 cells were seeded in 96-well plates and cultured for 24 h prior to the addition of CF or EAF. The medium was changed three times every 3 days and replaced with fresh medium containing the corresponding extracts. At different time points (3, 6 or 9 days), medium was collected and the HBV DNA content was measured. Under the same conditions, 3TC was used as a positive control. Con, control; CF, chloroform fraction; EAF, ethyl acetate fraction; HBV, hepatitis B virus; 3TC, 2′-3′deoxy-3′-thiocytidine.
IC50 (mg/l) of extracted BNL fractions on HBsAg and HBeAg secretion from HepG2.2.15 cells.
HBsAg (days) | HBeAg (days) | |||||
---|---|---|---|---|---|---|
|
| |||||
Fractions | 3 | 6 | 9 | 3 | 6 | 9 |
PEF | - | 176.30 | 73.00 | - | 130.10 | 94.73 |
CF | - | 33.43 | 20.92 | 77.90 | 28.05 | 19.67 |
EAF | 143.00 | 52.90 | 39.90 | 93.30 | 67.82 | 36.45 |
nBF | - | - | 103.10 | - | 127.51 | 63.48 |
AF | - | - | - | 21.38 | 133.07 | 157.12 |
3TC | - | - | 86.80 | - | - | 29.44 |
IC50, inhibitory concentration 50; BNL,
Effects of CF and EAF from BNL on the inhibition of HBsAg secretion by HepG2.2.15 cells (n=3).
3 days | 6 days | 9 days | 9 days | |||||
---|---|---|---|---|---|---|---|---|
|
|
|
| |||||
Groups | Concentration (mg/l) | OD | Inhibition (%) | OD | Inhibition (%) | OD | Inhibition (%) | Cell survival (%) |
Control | 1.434±0.249 | - | 1.206±0.328 | - | 0.549±0.128 | - | 100.00 | |
CF | 100 | 0.822±0.176 |
44.1±12.71 | 0.203±0.079 |
88.68±6.96 | 0.100±0.009 |
94.00±1.78 | 115.92 |
50 | 1.130±0.224 | 21.92±16.15 | 0.511±0.188 | 61.45±16.61 | 0.146±0.010 |
84.37±2.18 | 98.24 | |
25 | 1.241±0.099 | 13.94±7.11 | 0.690±0.194 | 45.59±14.52 | 0.199±0.013 |
73.14±2.73 | 87.86 | |
12.5 | 1.224±0.251 | 15.14±18.13 | 1.064±0.231 | 12.56±20.41 | 0.457±0.074 | 19.27±15.43 | 129.90 | |
EAF | 200 | 1.087±0.201 |
56.81±8.50 | 0.253±0.072 |
84.29±6.39 | 0.119±0.011 |
89.95±2.26 | 97.36 |
100 | 0.853±0.065 |
41.86±4.72 | 0.460±0.126 |
65.93±11.10 | 0.174±0.036 |
78.37±7.53 | 74.23 | |
50 | 1.041±0.037 | 28.33±2.69 | 0.600±0.104 | 53.55±9.16 | 0.238±0.017 | 64.97±3.60 | 76.96 | |
25 | 1.244±0.158 | 13.67±11.39 | 0.910±0.062 | 26.20±5.44 | 0.406±0.007 |
29.80±1.49 | 67.63 | |
3TC | 200 | 0.910±0.110 |
37.78±7.97 | 0.699±0.062 |
44.83±5.44 | 0.258±0.017 |
60.92±3.48 | 76.87 |
100 | 0.974±0.202 | 33.14±14.55 | 0.826±0.136 | 33.63±12.07 | 0.283±0.073 | 55.62±15.26 | 67.19 | |
50 | 1.100±0.196 | 24.08±14.13 | 0.962±0.021 | 21.60±1.86 | 0.358±0.062 | 39.92±12.99 | 78.54 | |
25 | 1.295±0.177 | 10.00±12.79 | 1.273±0.111 | −5.95±9.85 | 0.698±0.079 | −31.18±16.43 | 125.86 |
Data are presented as means ± standard error of the mean.
P<0.05 and
P<0.01 vs. control.
OD, optical density; CF, chloroform fraction; EAF, ethyl acetate fraction; BNL,
Effects of CF and EAF from BNL on the inhibition of HBeAg secretion by HepG2.2.15 cells (n=3).
3 days | 6 days | 9 days | 9 days | |||||
---|---|---|---|---|---|---|---|---|
|
|
|
| |||||
Groups | Concentration (mg/l) | OD | Inhibition (%) | OD | Inhibition (%) | OD | Inhibition (%) | Cell survival (%) |
Control | 2.948±0.135 | - | 2.660±0.315 | - | 1.088±0.229 | - | 100.00 | |
CF | 100 | 1.248±0.226 |
58.77±7.83 | 0.323±0.137 |
89.52±5.25 | 0.057±0.004 |
100.19±0.35 | 115.92 |
50 | 1.901±0.291 |
36.19±10.06 | 0.953±0.256 |
65.39±9.79 | 0.145±0.027 |
91.67±2.67 | 98.24 | |
25 | 2.183±0.102 |
26.45±3.54 | 1.453±0.332 |
46.24±12.72 | 0.253±0.007 |
81.18±0.70 | 87.86 | |
12.5 | 2.410±0.296 |
18.59±10.23 | 2.055±0.330 | 23.18±12.63 | 0.930±0.174 | 15.32±16.9 | 129.90 | |
EAF | 200 | 0.820±0.216 |
73.57±7.46 | 0.340±0.108 |
88.87±4.13 | 0.070±0.015 |
98.90±1.42 | 97.36 |
100 | 1.499±0.314 |
50.09±10.87 | 0.988±0.184 |
64.04±7.03 | 0.160±0.050 |
90.15±4.86 | 74.23 | |
50 | 2.120±0.142 |
28.63±4.91 | 1.495±0.139 |
44.63±5.33 | 0.347±0.029 |
71.98±2.85 | 76.96 | |
25 | 2.398±0.182 |
19.02±6.28 | 2.383±0.219 | 10.60±8.39 | 0.809±0.075 | 27.15±7.29 | 67.63 | |
3TC | 200 | 1.752±0.330 |
41.34±11.40 | 1.814±0.151 |
32.39±5.77 | 0.358±0.017 |
80.69±1.62 | 76.87 |
100 | 1.901±0.420 | 36.19±14.53 | 2.058±0.384 | 23.06±14.72 | 0.283±0.073 | 78.23±7.09 | 67.19 | |
50 | 2.126±0.478 | 28.42±16.53 | 2.203±0.204 | 17.50±7.80 | 0.358±0.062 | 70.94±6.03 | 78.54 | |
25 | 2.388±0.176 | 19.38±6.07 | 2.596±0.199 | 2.44±7.61 | 0.698±0.079 | 37.93±7.63 | 125.86 |
Data are presented as means ± standard error of the mean.
P<0.01 and
P<0.05 vs. control.
OD, optical density; CF, chloroform fraction; EAF, ethyl acetate fraction; BNL,