MTT, dimethyl sulfoxide (DMSO) and G418 were purchased from Sigma (St. Louis, MO, USA). The ELISA kit for HBsAg and HbeAg was obtained from the Sino-American Biotechnology Company (Luoyang, China). The HBV DNA extraction and amplification fluorescence assay kit was purchased from Guangzhou Da An Gene Co., Ltd. of Sun Yat-Sen University (Guangzhou, China). High-glucose Dulbecco’s modified Eagles medium (DMEM), trypsin, EDTA, L-glutamine and fetal bovine serum (FBS) were purchased from Gibco-BRL (Carlsbad, CA, USA). Lamivudine, also referred to as 2′-3′deoxy-3′-thiocytidine (3TC), was obtained from GlaxoSmithKline Pharmaceuticals Co., Ltd. (Brentford, UK) and freshly prepared before use.

The Boehmeria nivea (Linn.) Gaudich used in this study was grown in the suburbs of Guilin (Guangxi, China) and the leaves were collected. The protocol for the extraction of the BNL fractions is summarized in Fig. 1. Briefly, the components of BNL were obtained with reflux extraction from 7 kg of dried leaves with 70–80% ethanol three times. The extracts were then pooled, concentrated by reduced pressure and went through D101 macroporous adsorption resin (Tianjin Science and Technology Co., Ltd, Tianjin, China) followed by water and ethanol elution. The ethanol-eluted fraction was enriched and 240 g of extract was obtained. The extract was then diluted with water and stirred thoroughly to yield a turbid suspension. The suspension was extracted with petroleum ether, chloroform, ethyl acetate and n-butanol, respectively. Finally, 27, 35, 25, 75 and 34 g of petroleum ether, chloroform, ethyl acetate, n-butanol and aqueous extracts, respectively, were harvested.

Five fractions extracted from BNL [petroleum ether fraction (PEF), chloroform fraction (CF), ethyl acetate fraction (EAR), n-butanol fraction (nBF) and aqueous fraction (AF)]were dissolved in ethanol and their chemical compositions were assayed qualitatively, as described previously (5–7).

HepG2.2.15 cells transfected with human HBV DNA were provided by the Beijing No. 302 Hospital and maintained in DMEM supplemented with 10% FBS, 1% penicillin/streptomycin and 200 mg/l G418 in a humidified atmosphere of 5% CO₂ at 37°C. For treatment, 1×10⁴ cells were seeded in a 96-well plate and cultured for 24 h prior to extract addition. The extracts were dissolved in DMSO and diluted to proper concentrations. The medium was changed three times every 3 days using fresh medium containing the corresponding extracts. At different time points (3, 6 and 9 days), medium was collected and stored at −20°C until use. Under the same conditions, a blank group was used as the negative control and 3TC as the positive control.

In order to investigate the cytotoxic effects of the BNL extracts, the MTT assay was used. Briefly, the HepG2.2.15 cells were seeded in a 96-well plate and treated with the different extracts for 9 days. Following treatment, the medium was replaced with an equal volume of fresh medium containing 5 mg/ml MTT and the plate was incubated for 4 h at 37°C. The MTT was removed and the cells were lysed with DMSO. The dark blue formazan crystals formed in intact cells were solubilized by shaking for 15 min and the absorbance at 570 nm was measured with an Elx800 type ELISA analyzer microplate reader (BioTek Instruments, Inc., Winooski, VT, USA). The cell growth rate was expressed as a percentage of the control.

HBsAg and HBeAg in the conditioned medium were quantified using two antibody sandwich ELISA kits (Sino-American Biotechnology Company), according to the protocol provided by the manufacturer.

The amount of HBV DNA in the cultured medium was measured by QF-PCR. Total RNA was extracted from HepG2.2.15 cells treated with different concentrations of CF (12.5, 25, 50 and 100 mg/l), EAF (25, 50, 100 and 200 mg/l) and 3TC (positive control; 25, 50, 200 mg/l) for 3, 6 and 9 days, using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). The primers used in this study were as follows: P1, 5 ‘ATCCTGCTGCTATGCCTCATCTT 3′; P2, 5′ ACAGTGGGGGAAAGCCCTACGAA 3′; fluorescent probe sequence, 5′ GGCTAGTTTACTAGTGCCATTTG 3′. The amplification parameters included predegeneration at 93°C for 2 min, followed by 10 cycles of denaturation at 93°C for 45 sec and annealing at 55°C for 1 min; the condition was then changed to 30 cycles of denaturation at 93°C for 30 sec and annealing at 55°C for 45 sec.

Data are presented as the means ± standard error of the mean and the Student’s t-test was applied for statistical analysis to determine the statistical significance. P<0.05 was considered to indicate a statistically significant difference.

To investigate the effects of the BNL extracts on HBsAg and HBeAg secretion by HepG2.2.15 cells, we first determined the inhibitory concentration 50 (IC₅₀) of the different BNL extracts. As shown in Table I, the CF was the most potent inhibitor of HBsAg and HBeAg secretion, followed by EAF. Of note, the AF was more efficient in inhibiting the HBeAg secretion by HepG2.2.15 cells at the 3-day time point compared to other extracts and other time points. In addition, we observed that CF and EAF inhibited HBsAg (Table II) and HBeAg (Table III) secretion by HepG2.2.15 cells in a concentration- and time-dependent manner. After 9 days of CF treatment (100 mg/l), the secretion of HBsAg was reduced by 94.00±1.78% and that of HBeAg by 100.19±0.35% (Tables II and III, respectively). Furthermore, after 9 days of EAF treatment (200 mg/l), the secretion of HBsAg and HBeAg was reduced by 89.95±2.26 and 98.90±1.42%, respectively (Tables II and III).

In order to determine the effects of CF and EAF on HBV DNA secretion by HepG2.2.15 cells, QF-PCR was performed. As shown in Fig. 2, CF and EAF were shown to significantly reduce the content of HBV DNA in the medium secreted by HepG2.2.15 cells compared to that of the control. These data indicated that CF and EAF inhibited HBV DNA replication. In addition, CF was shown to be more potent compared to EAF (Fig. 2). As a positive control, 3TC (200 mg/ml) reduced the content of HBV DNA in the medium secreted by HepG2.2.15 cells at 3, 6 and 9 days (Fig. 2).

To determine whether the anti-HBV effects of the BNL extracts were due to cytotoxicity, the effects of BNL extracts on HepG2.2.15 cell proliferation were assessed by the MTT assay. After 9 days of treatment, HepG2.2.15 cell growth was found to be unaffected by CF or EAF treatment (Tables II and III).

In order to determine the chemical composition of the BNL extracts, a qualitative assay was performed as previously described (5–7). The qualitative assay determined that PEF contained anthraquinones, phenols, volatile oils, steroids, terpenes, amino acids, reducing sugars, polysaccharides and organic acids; CF contained anthraquinones, phenols, steroids, terpenes, amino acids, organic acids, lactones and coumarins; EAF contained flavonoids, anthraquinones, phenols, lactones, coumarins, volatile oils, sterols, terpenes, amino acids, reducing sugars, polysaccharides and organic acids; nBF contained anthraquinones, phenols, lactone, coumarins, amino acids, reducing sugars and polysaccharides; and AF contained flavonoids, phenols, saponins, amino acids, reducing sugars, polysaccharides and organic acids.