The ARPE-19 human RPE cell line was purchased from the American Type Culture Collection (Manassas, VA, USA) and grown in Dulbecco’s modified Eagle’s medium (DMEM) containing 10% heat-inactivated fetal bovine serum (FBS; Gibco, Invitrogen Life Technologies, Carlsbad, CA, USA), 100 µg/ml streptomycin and 100 U/ml penicillin (Harbin Pharmaceutical Group Co., Ltd., Harbin, China) in 5% CO₂ at 37°C. The cells were passaged approximately every 3 days and subcultured at ~90% confluence.

ARPE-19 cells were grown to 80% confluence, at ~2000 cells/well in 96-well plates. Cells were subsequently treated with oxidized low density lipoprotein (oxLDL; 200 µg/ml; Kalen Biomedical, Montgonery Village, MD, USA) or H₂O₂ (50 µM) for 24 h. Proliferation and apoptosis were assessed using a Cell Titer 96^® AQueous One Solution reagent (Promega Corporation, Madison, WI, USA) and an Annexin V-fluorescein isothiocyanate apoptosis detection kit (Sigma-Aldrich, St. Louis, MO, USA) according to the manufacturer’s instructions. Briefly, 1−5×10⁵ cells were resuspended in 0.5 ml binding buffer and incubated with annexin V-fluorescein isothiocyanate and propidium iodide for 10 min in the dark at room temperature. A FACScan flow cytometer (BD Biosciences) equipped with a FITC signal detector FL1 (excitation 488 nm) and a phycoerythrin emission signal detector FL3 (excitation 585 nm) was used to analyze cellular apoptosis. The results were calculated using the CellQuestTM Pro software (BD Biosciences) and expressed as the percentage of apoptotic cells from the total cells.

Intracellular ROS levels were measured using an intracellular ROS assay kit (Cell Biolabs, San Diego, CA, USA). Briefly, ARPE-19 cells were incubated with 2′,7′-dichlorodihydro fluorescin diacetate (DCFH-DA) in the culture medium for 30 min at 37°C. Subsequently, the pre-loaded cells were treated with oxLDL (200 µg/ml) or H₂O₂ (50 µM) for 24 h or as described in the figure legends. DCFH fluorescence of the cell lysate was observed by using fluorescence microscope (OLYMPUS, Japan). Imags were captured using a Digital SLR camera (Canon, Beijing, China). The fluorescence intensity of each reaction mixture was determined and quantified using Image J software v1.4 (National Institutes of Health, Bethesda, MA, USA).

Cell senescence was measured using a cellular senescence assay kit associated β-gal (SA-β-gal) assay (Cell Biolabs, San Diego, CA, USA), assay according to the manufacturer’s instructions. Briefly, ARPE-19 cells were cultured to ~2000 cells/well in 96-well plates, and then exposed to oxLDL (200 µg/ml) or H₂O₂ (50 µM) for 24 h in a 37°C incubator. Following washing and collection, cells were treated with freshly prepared fluorometric substrate for 2 h at 37°C in the dark. The fluorescence intensity of each reaction mixture was determined and quantified using Image J software (NIH). The average fluorescence intensity was analyzed from five fields for each treatment.

Cells were incubated with H₂O₂ (50 µM) for 24 h. Subsequently, H₂O₂ was detoxified by the addition of catalase (100,000 µl; Worthington Biochemical Corp., Lakewood, NJ, USA) at the end of the incubation (22). oxLDL (200 µg/ml) was added to other samples to induce pathological stress in ARPE-19 cells following 24 h treatment (23). To further evaluate the effects of SirT1, resveratrol (RSV; 10 mM) and nicotinamide (NA; 5 mM) (Sigma-Aldrich) were applied to incubated cells prior to oxidant treatments (24). The pRC/CMV-STAT3 and pcRC/CMV expression vectors (STAT3OV and C-STAT3OV) were acquired from Promega Corporation and used to evaluate the effects of STAT3 overexpression. SirT1 and STAT3 knockdown were performed using small interfering (si)RNA for SirT1 (Santa Cruz Biotechnology Inc., Dallas, TX, USA) and short hairpin (sh)RNA STAT3/Puro (STAT3KO; Sigma-Aldrich) lentiviral vectors, respectively. shRNAi Mission Non-Target shRNA Control/Puro (Sigma-Aldrich) was used as a negative control of gene knockdown (C-SirT1KO and C-STAT3KO). Cell transfection was performed using Lipofectamine^® 2000 reagent (Invitrogen Life Technologies) according to the manufacturer’s instructions.

Total RNA was extracted using RNeasy kits (Qiagen, Valencia, CA, USA) and first-strand complementary DNA was synthesized using SuperScript III (Invitrogen Life Technologies). RT-qPCR was performed on an ABI 7500 (Applied Biosystems Life Technologies, Foster City, CA, USA) with a SYBR Premix Ex Taq™ kit (Takara Bio, Inc., Otsu, Japan). GAPDH was used as the internal control. Data were normalized using the 2^−ΔΔCt method for relative quantification. The primers were as follows: Forward: GGGTGGAGAAGGACATCAGCGGTAA and reverse: GCCGACAATACTTTCCGAATCC for STAT3, forward: TGTGGTAGAGCTTGCATTGATCTT and reverse: GGCCTGTTGCTCTCCTCAT for SirT1 and forward: GGAGTCAACGGATTTGGTC and reverse: GGAATCATTGGAACATGTAAAC for GAPDH. The reactions began at 95°C for 5 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 30 sec, and extension for 1 min at 72°C.

Cell lysates were acquired from the collected cells cell lysis reagent (Promega, Madison, WI, USA), containing Complete Mini protease inhibitor cocktail (Roche). The protein concentration was determined by using Bradford Reagent (Bio-Rad) and the protein samples were subjected to 10% SDS-PAGE. The proteins were subsequently transferred onto nitrocellulose membranes and the membranes were blocked with 50 mM Tris-HCl (pH 7.5), 150 mM NaCl and 0.05% Tween-20 (TBST), containing 5% non-fat milk or 5% bovine serum albumin (Sigma-Aldrich) for 30 min. The membranes were subsequently incubated with rabbit monoclonal primary antibodies against STAT3 (1:500; Minneapolis, MI, USA), phosphospecific STAT3 (Tyr705) (1:500; Cell Signaling Technology, Inc., Danvers, MA, USA), SirT1 (1:500; Sigma-Aldrich) and mouse β-actin (1:1,000; Sigma-Aldrich) overnight at 4°C. Subsequently, goat anti-mouse immunoglobulin G (IgG) or goat anti-rabbit IgG (Pierce Biotechnology, Inc., Thermo Fisher Scientific, Rockford, IL, USA) were utilized to visualize the results, which were detected using enhanced chemiluminescence detection systems (Super Signal West Femto; Pierce Biotechnology, Inc.).

Values are presented as the mean ± standard deviation. Student’s t-test was used to analyze differences between two groups. The experimental results were analyzed with one-way analysis of variance to compare the differences between three or more groups. P<0.05 was considered to indicate a statistically significant difference. Statistical analyses were conducted using SPSS 17.0 software (SPSS, Chicago, IL, USA). All experiments were performed in triplicate.

In order to mimic the oxidative damage that occurs in AMD, H₂O₂ and oxLDL have been previously employed as experimental oxidants, with which to induce pathological stresses in RPEs (25,26). Following treatment with H₂O₂ (50 µM) or oxLDL (200 µg/ml) for 24 h, the proliferation, apoptosis, intracellular ROS and senescence of ARPE-19 cells were analyzed. It was revealed that H₂O₂ and oxLDL significantly elevated cellular proliferation (Fig. 1A; P=0.020 and P=0.026, respectively) and significantly enhanced the apoptotic rate (Fig. 1B; P=0.013 and P=0.003, respectively), compared with that of the control group. Due to the association of an accumulation of intracellular ROS with AMD (27), the intracellular ROS levels were also evaluated. H₂O₂ and oxLDL significantly increased the intracellular ROS levels in RPEs (P=0.040 and P=0.016, respectively), compared with those of the control group (Fig. 1C). Cellular senescence has a critical function in contributing to AMD, and the biological ageing process is associated with an increase in senescence (25). The cellular senescence of RPEs induced by H₂O₂ or oxLDL was evaluated using an SA-β-gal assay. As indicated in Fig. 1D, oxLDL and H₂O₂ promoted cell senescence, compared with the control group, with a significant difference following treatment with H₂O₂ (P=0.045).

To analyze the effects of SirT1 and STAT3 on oxidative stress, the expression of SirT1 and STAT3 in RPEs was assessed. Notably, the expression of SirT1 mRNA was found to be downregulated in RPEs treated with H₂O₂ and oxLDL, when compared with that in the control group (P=0.005 and P=0.039, respectively). Conversely, the expression of STAT3 mRNA was demonstrated to be upregulated (P=0.012 and P=0.020, respectively), as shown in Fig. 1E and F. These results demonstrated that oxidative stress induced RPE damage and resulted in the dysregulation of SirT1 and STAT3 mRNA expression.

In order to evaluate the effects of SirT1 in oxidative stress, RPEs were pretreated with the SirT1 inhibitor, NA, or the SirT1 activator, RSV, prior to treatment with H₂O₂ (50 µM) or oxLDL (200 µg/ml) for 24 h. The proliferation (Fig. 2A), apoptosis (Fig. 2B), intracellular ROS (Fig. 2C) and senescence (Fig. 2D) of RPEs were subsequently evaluated. NA enhanced the effects of H₂O₂, markedly decreasing the proliferation rate (P=0.049), stimulating apoptosis (P=0.028), as well as increasing intracellular ROS and senescence in RPEs. Conversely, RSV was able to resist the effects of H₂O₂. To examine whether SirT1 had analagous effects on RPEs treated with oxLDL, identical experiments were performed following oxLDL treatment. Furthermore, the SirT1 activator, RSV, exerted opposite effects on the regulation of RPEs, when compared with the effects of NA, as indicated in Fig. 2.

In the present study, an overexpression of STAT3, which was involved in STAT3 activation during oxidative stress in RPEs, was identified. In order to better understand the protective roles of SirT1 in RPEs during oxidative stress, the association between STAT3 activation and SirT1 required elucidation. Differences in the expression of STAT3 following SirT1 knockdown, or overexpression in RPEs during oxidative stress were evaluated. As shown in Fig. 3A, the SirT1 activator, RSV, significantly decreased the expression of STAT3 (P=0.048), while a significant increase in STAT3 expression was detected in RPEs following SirT1 knockdown (P=0.025), compared with that in the control, during H₂O₂ treatment. Furthermore, SirT1 knockdown was also found to promote the expression of STAT3 protein and phosphorylated STAT3 protein during oxidative stress (Fig. 3B), whereas RSV and SirT1 knockdown did not influence the expression of STAT3 in the absence of oxidative stress (Fig. 3A and B). The results presented in Fig. 3B demonstrate the efficiency of SirT1 knockdown. To further investigate the association between STAT3 and SirT1, the expression of SirT1 following STAT3 knockdown (STAT3KO group) or overexpression (STAT3OV group) was evaluated in RPEs during oxidative stress. The expression of STAT3 protein was determined in each group by western blot analysis, as shown in Fig. 3C. Notably, overexpression of STAT3 induced a decrease in the expression of SirT1, when compared with that in the C-STAT3OV group (P=0.022), during oxidative stress. The expression of SirT1 was significantly enhanced in the STAT3KO group (Fig. 3D; P=0.015). These results indicated that STAT3 exerts negative effects on the expression of SirT1 in RPEs during oxidative stress.

STAT3 activation has been associated with the protection of retinal cells during injury, including that induced by oxidative stress (28). Therefore, in order to confirm the association between the effects of STAT3 in the protection of cells and the protective roles of SirT1 during oxidative stress, the effects of STAT3 on oxidative stress following pretreatment with the SirT1 inhibitor, NA, were assessed. As shown in Fig. 4, STAT3 increased cell proliferation (Fig 4A), decreased apoptosis (Fig. 4B) and increased intracellular ROS (Fig. 4C) in the presence of NA. However, STAT3 did not influence cell senescence (Fig. 4D). These results revealed that STAT3 directly protected the cells from oxidative stress rather than depending on SirT1 activity. They also suggested that the protective effects of STAT3 were not associated with the modulation of cellular senescence during oxidative stress. Notably, these results suggested that there is an equilibrium mechanism between the functions of SirT1 and STAT3 against oxidative stress, due to their specific interactions and effects in RPEs.