ACHN cells were purchased from the Cell Bank of Chinese Academy of Sciences (Shanghai, China) and cultured in RPMI 1640 supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin and 100 U/ml streptomycin. Cells were maintained in a humidified incubator at 5% CO₂ at 37°C (29).

Five primary CCRCC and paired normal renal tissues were collected, between January 2010 and July 2011, from the Second Hospital, Jilin University (Changchun, China; 4 male and 1 female). All cases were confirmed clinical and pathologically and staged in accordance with the 2009 TNM staging classification system (30). The samples were snap-frozen in liquid nitrogen and stored at −80°C until further analysis or fixed in 4% paraformaldehyde. Written informed consent was obtained from all the patients or their guardians, and the protocol was approved by the Ethics Committee of the Second Hospital affiliated to Jilin University (Changchun, China).

Antibody against phosphorylated (p)-HDM2 (Ser166; 1:1,000, Rabbit polyclonal antibody, cat. no. 3521) was purchased from Cell Signaling Technology (Danvers, MA, USA). Antibodies against total (T)-Akt (1:1,000, Rabbit polyclonal; cat. no. ab8806), p-AKT (Ser473; 1:1000, Rabbit Polyclonal; cat. no. ab66138), HDM2 (1:1,000, Mouse monoclonal; cat. no. ab10567), PTEN (1:1,000, Rabbit polyclonal, cat. no. ab31392) and p53 (1:1,000, Rabbit monoclonal; cat. no. ab179477) were purchased from Abcam (Cambridge, UK); poly (ADP ribose) polymerase (PARP cleaved), p53 upregulated modulator of apoptosis (PUMA, 1:1,000; mouse monoclonal; cat. no. sc-374223), GAPDH (1:1,000; mouse monoclonal; cat. no. sc-365062), rabbit anti-mouse immunoglobulin (Ig) G-horseradish peroxidase (HRP; 1:2,000; cat. no. sc-358922) and mouse anti-rabbit IgG-HRP (cat. no. sc-2357) were obtained from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). Protein A/G-beads and the enhanced chemiluminescence (ECL) immunoblotting detection reagent were purchased from Santa Cruz Biotechnology, Inc.; Etoposide was from Sigma-Aldrich (St Louis, MO, USA); Lipofectamine 2000 and TRIzol were purchased from Invitrogen Life Technologies (Carlsbad, CA, USA); Moloney murine leukemia virus (M-MLV) reverse transcriptase was from Promega (Madison, WI, USA). SYBR polymerase chain reaction (PCR) premixture was from Applied Biosystems (Foster City, CA, USA). Cell Counting Kit-8 was from Dojindo Laboratories (Kumamoto, Japan). pSUPERIOR.puro plasmid was obtained from Oligoengine (Seattle, WA, USA).

The PTEN (GenBank accession number, NM_000314; AAGACCATAACCCACCACAGC) shRNA target sequences were designed by GeneChem Company (Montreal, Quebec, Canada) (forward, 5′-GACCAUAACCCACCACAGCTT-3′ and reverse, 5′-GCUGUGGUGGGUUAUGGUCTT-3′). The oligonucleotide-annealed products were subcloned into pSUPERIOR.puro (Oligoengine) between the BglII and HindIII sites.

For transfection, ACHN cells were seeded onto a 96-well plate (5×10³ cells/well) and following 24 h, cells were transfected with the indicated shRNA using Lipofectamine 2000 according the manufacturer’s instructions.

The total mRNA of tissues and ACHN cells was prepared using TRIzol according to the manufacturer’s instructions. Reverse transcription was performed with M-MLV reverse transcription kit. qPCR assays were performed with iTaq Fast SYBR Green Supermix (Bio-Rad) on a 7500 Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). The primers for qPCR were as follows: PTEN 5′-GTTCAGTGGCGGAACTTGCAATCCT-3′ (forward) and 5′-TCCCGTCGTGTGGGTCCTGA-3′ (reverse). Cycling conditions were as follows: 40 cycles of 95°C for 15 sec; 95°C for 20 sec and 60°C for 1 min. ^ΔΔCT method was used for the quantification of the products.

Tissues or cells were collected and homogenized in radioimmunoprecipitation (RIPA) lysis buffer [50 mM Tris-HCl (PH 7.4), 150 mM NaCl, 1 mM phenyl methyl sulphonyl fluoride (PMSF; Beyotime Institute of Biotechnology, Shanghai, China), 1% Triton X-100 (Beyotime Institute of Biotechnology), 0.1% SDS (Amresco, OH, USA), 1% sodium deoxycholic acid (Amresco) and 1X protease inhibitor cocktail (Sigma-Aldrich)]. Then the homogenate was centrifuged at 7,300 × g for 10 min and the supernatant was collected. The protein concentration was measured using the bicinchoninic acid (BCA) protein assay kit (Beyotime, Shanghai, China). 40 µg protein was subjected to 12% SDS-PAGE (Beyotime Institute of Biotechnology) and then electrophoretically transferred to a polyvinylidene difluoride (PVDF) membrane (Millipore Corp., Billerica, MA, USA). Following blocking with 5% skimmed milk (Amresco) for 1 h at room temperature, the membrane was incubated with the primary antibody for 1 h at room temperature. The membrane was washed with Tris-buffered saline containing Tween 20 (TBST; Beyotime Institue of Biotechnology) three times for 5 min each time. Then the membrane was incubated with HRP-conjugated secondary antibody for 1 h at room temperature. Following three washes with TBST, the positive signal was visualized using ECL Advanced Solution (Pierce, Thermo Fisher Scientific, Waltham, MA, USA).

A total of 10 µl protein A-sepharose slurry (Santa Cruz Biotechnology, Inc.) was added to the lysate prepared as above. The mixture was agitated at 4°C for 30 min and then centrifuged at 7,200 × g for 5 min. The supernatant was collected and transferred to a fresh Eppendorf tube. Subsequently, 2 µg of the indicated antibodies and 20 µl of the protein A-sepharose slurry were added to the pre-cleared lysate, and incubation was performed overnight at 4°C with continuous agitation. The immunocomplexes were washed three times with pre-cooled RIPA lysis buffer and precipitated proteins were eluted by boiling in 20–40 µl 1X SDS-PAGE loading buffer (Beyotime Institute of Biotechnology). The samples were then subjected to western blot analysis.

Tissues were fixed with parafor-maldehyde (4%; Sigma-Aldrich), then embedded in paraffin and sectioned. Sections were deparaffinized in xylol (Beyotime Institute of Biotechnology) and rehydrated in a graded ethanol series (China National Medicines, Shanghai, China). Following antigen retrieval by microwave heating (600 W; 15 min; P70F23P-G5; Galanz, Guangdong, China), the sections were incubated in non-immune serum (Santa Cruz Biotechnology, Inc.) for 30–60 min at room temperature and then blotted with the indicated primary antibody against p-Akt, p-HDM2 (Ser166), p53 or PTEN, overnight at 4°C. The next day, the sections were incubated in rabbit HRP-conjugated secondary antibody for 1 h at room temperature.

Finally, the sections were visualized with 3,3′-diamino-benzidine hydrochloride (Sigma-Aldrich) and counterstained with hematoxylin (Beyotime Institute of Biotechnology).

Cells were detached with 0.25% trypsin (Beyotime Institute of Biotechnology), collected, washed with ice-cold phosphate-buffered saline (PBS; Beyotime Institute of Biotechnology) and then fixed in 70% ice-cold ethanol for 1 h. The cell suspension was centrifuged for 5 min at 1,000 rpm. The supernatant was removed and cells were re-suspended in PBS. Subsequently, 50 µg/ml RNase A (Promega) and 25 µg/ml propidium iodide (PI; Sigma-Aldrich) were added and kept at 37°C for 30 min. The DNA contents of >10,000 cells were detected using a FACSCalibur (BD Biosciences, San Jose, CA, USA). Quantitative analysis of the cell cycle distribution was performed using WinMDI 2.9 (Dr Joseph Trotter, The Scripps Institute, La Jolla, CA, USA).

24 h prior to transfection, 2.5×10³ cells were seeded onto 96-well cell culture plates. Transfection was performed using Lipofectamine 2000 according to the manufacturer’s instructions. 24 h post-transfection, 30 µM etoposide or mock were added. Following a further 24 h incubation, 10 µl CCK-8 solution was added to each well of the plate, followed by 1 h incubation at 37°C. The optical density (OD) was then measured at 450 nm using a microplate reader (MK3; Thermo Fisher Scientific). The cell inhibitory rate was calculated according to the following equation: [1−(OD_experiment−OD_blank)/(OD_control−OD_blank)] ×100%. All experiments were performed in triplicate and repeated three independent times.

Values are expressed as the mean + standard error. Student’s t-test was used for statistical analysis of the data to determine the differences between the groups using SPSS 11.5 for Windows software (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference between values.

In the present study, the expression of PTEN was analyzed in five pairs of CCRCC tissues and the corresponding normal renal tissues. qPCR analysis showed that PTEN mRNA was decreased in CCRCC tissues (Fig. 1A). In accordance with the qPCR results, western blot analysis and immunohistochemistry showed that the expression levels of PTEN protein were obviously decreased in CCRCC tissues (Fig. 1B and C). These results suggested that loss of PTEN is correlated with CCRCC development.

To identify whether PTEN has a role in the sensitivity of CCRCC to chemotherapy drugs, PTEN was silenced in the CCRCC cell line ACHN using shRNA. As shown in Fig. 2A, following transfection with PTEN shRNA, PTEN was effectively downregulated in ACHN cells. Results of the CCK-8 assay showed that knockdown of PTEN promoted proliferation of ACHN cells with or without treatment with etoposide (Fig. 2B). Cell cycle analysis revealed that treatment with etoposide induced cell cycle arrest and apoptosis in ACHN cells, while PTEN knockdown resulted in a decreased sub G0/G1 phase population in the presence or absence of etoposide (Fig. 3C). These results demonstrated that loss of PTEN in ACHN cells inhibited etoposide-induced cell apoptosis and promoted cell proliferation.

PTEN is a specific antagonist of PIP3, which blocks PI3K/Akt signaling through dephosphorylation of PIP3 (24). Increasing evidence showed that loss of PTEN resulted in abnormal activity of Akt (31). In the present study, etoposide-treatment of ACHN cells increased phosphorylation of Akt (Fig. 3A); furthermore, HDM2, an important substrate of Akt, was significantly inhibited. p53, PUMA and cleaved PARP were obviously induced. Knockdown of PTEN in ACHN greatly reversed the inhibition effect of etoposide on Akt and HDM2 activation. The etoposide-induced upregulation of p53, PUMA and cleaved PARP were also reduced following PTEN knockdown. These results suggested that PTEN knockdown activated the Akt/HDM2 signaling pathway and blocked p53-dependent cell apoptosis (Fig. 3A).

HDM2 is a negative regulator of tumor suppressor p53, which inhibits the transcriptional activity of p53 and targets p53 for degradation (26). Immunoprecipitation results showed that knockdown of PTEN enhanced the interaction between p53 and HDM2 (Fig. 3B). The results further demonstrate that loss of PTEN in ACHN cells activated the Akt/HDM2 signaling pathway and promoted the interaction between p53 and HDM2, which led to degradation of p53 and resulted in block of apoptosis induced by etoposide.

To further verify that PTEN deficiency is critical in chemoresistance of CCRCC, the Akt/HDM2 signaling pathway in CCRCC tissues was analyzed. Western blot analysis showed that HDM2, p-HDM2 (ser166) and p-AKT were upregulated in CCRCC tissues alongside low p53 expression (Fig. 4A). The immunohistochemistry results were in accordance with the western blot results (Fig. 4B). Furthermore, immunoprecipitation also revealed that interaction between p53 and HDM2 was increased in CCRCC tissues. These data confirmed that loss of PTEN in CCRCC is attributed to activation of Akt/HDM2 and enhancement of the interaction between p53 and HDM2, eventually resulting in a reduction of p53.