The GES-1, MGC-803, BGC-823 and SGC-7901 human gastric carcinoma cell lines as well as HEK293T cells were purchased from American Type Culture Collection (Manassas, VA, USA) and were cultured in Dulbecco's modified Eagle's medium (DMEM)/F12 (GE Healthcare Life Sciences, Logan, UT, USA) supplemented with 10% fetal bovine serum (FBS; GE Healthcare Life Sciences), 100 U/ml penicillin and streptomycin (Invitrogen Life Technologies, Carlsbad, CA, USA) in a 25 cm² culture flask at 37°C in a humidified atmosphere of 5% CO₂. Cells were treated with 10 ng/μl TNF-α for 48 h at 60% confluence.

Prior to transfection, 1.5×10⁵ cells/well were seeded into a 6-well plate in 2 ml DMEM culture medium containing FBS and antibiotics. Prior to transfection, the cells were incubated under normal growth conditions (37°C and 5% CO₂). Subsequently, the cells were transfected with miR-19a mimics, miR-19a inhibitors or miR negative controls for 48 h (Shanghai GenePharma Co., Ltd., Shanghai, China), which were pre-incubated with HiPerFect transfection reagent (Qiagen, Hilden, Germany), with a final concentration of miRNA analogues at 100 nmol/l.

Total RNA was extracted from the cell lines (5 mg) using TRIzol reagent (Invitrogen Life Technologies), according to the manufacturer's instructions.

TargetScan (http://www.targetscan.org/) was used to predict the target gene of miR-19a.

In order to detect and quantify mature microRNA-19a, a TaqMan MicroRNA Reverse Transcription kit and TaqMan MicroRNA assay were used, according to the manufacturer's instructions (Applied Biosystems, Life Technologies, Foster City, CA, USA). U6 RNA was used for normalization. To quantify the miRNA levels, 10 ng total RNA was reverse-transcribed using the Taq-Man MicroRNA Reverse Transcription kit, using specific primers for miR-19a and U6. Nucleotide primers used for reverse transcription were as follows (5′-3′): miR-19a, GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAGAGCA; U6, GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAAATATG. The primers used for real-time PCR were as follows (5′-3′): miR-291b-3p forward, GGCAAACAGCAAAAC; U6 forward, GCGCGTCGTGAAGCGTTC; Universal reverse primer, GTGCAGGGTCCGAGGT. Subsequently, PCR amplifications were performed in 20 μl reaction volumes, containing 10 μg TaqMan 2X Universal PCR Master Mix, 1 μl 20X TaqMan MicroRNA Assay mix (Applied Biosystems, Life Technologies) and 1.33 μl template cDNA in the same system used for mRNA quantitation (ABI 2720; Applied Biosystems). The thermal cycling conditions were as follows: 95°C for 10 min, followed by 40 cycles at 95°C for 15 sec and at 60°C for 1 min. The relative miRNA expression of miR-19a was normalized against the U6 RNA endogenous control using the 2^ΔΔCT method. Bio-Rad CFX Manager software (v 1.6; Bio-Rad Laboratories, Inc., Hercules, CA, USA) was used for the quantitative analysis of mRNA and miRNA.

The cellular proteins were extracted from the cells using radioimmunoprecipitation buffer, containing 50 mM Tris/HCl (pH 7.4), 150 mM NaCl and 1% (v/v) NP-40, and 0.1% (w/v) SDS (Beijing SolarBio Science & Technology Co., Ltd., Beijing, China), containing 1% (v/v) phenylmethanesulfonylfluoride (Beijing SolarBio Science & Technology Co., Ltd.), 0.3% (v/v) protease inhibitor (Sigma-Aldrich, St. Louis, MO, USA) and 0.1% (v/v) phosphorylated proteinase inhibitor (Sigma-Aldrich). The lysates were centrifuged at 13,000 ×g at 4°C for 15 min and the supernatant was collected for total protein analysis. A bicinchoninic protein assay kit (Pierce Biotechnology, Inc., Rockford, IL, USA) was used to determine the protein concentration. Equal quantities of protein (15 μg) were separated on an SDS-PAGE gel (10% (v/v) polyacrylamide) and transferred onto a polyvinylidene difluoride membrane (EMD Millipore, Billerica, MA, USA). Nonspecific binding was blocked using 8% (w/v) milk in Tris-buffered saline with 1% Tween-20 (TBST; Beijing SolarBio Science & Technology Co., Ltd.) for 2 h at room temperature. The membranes were then incubated with primary antibodies against β-actin (13E5) rabbit monoclonal antibody (mAb) (cat no. 4970; Cell Signaling Technology Inc., Beverly, MA, USA), NF-κB p65 (L8F6) mouse mAb (cat no. 6956; Cell Signaling Technology), NF-κB p65 (D14E12) XP^® rabbit mAb #9609 (Cell Signaling Technology Inc.); VCAM-1 (E1E8X) rabbit mAb #13662 (Cell Signaling Technology Inc.) ICAM-1 rabbit mAb #4915 (Cell Signaling Technology Inc.); MCP-1 rabbit mAb #2027 (Cell Signaling Technology Inc.) overnight at 4°C. Following several washes with TBST, the membranes were incubated in horseradish peroxidase (HRP)-conjugated goat anti-rabbit and anti-mouse immunoglobulin (Ig)G or HRP-conjugated mouse anti-goat IgG (all at a 1:5,000 dilution) for 2 h at room temperature and were then washed (five times with TBST for 10 min each). The target proteins were visualized using enhanced chemiluminescence (EMD Millipore), according to the manufacturer's instructions, and were quantified using density analysis normalized against β-actin, according to the manufacturer's instructions, with values expressed as the fold-changes, compared with the control.

NF-κB-specific small interfering (si)RNA (siHuR) and negative control were purchased from Shanghai Genepharma. 1×10⁵ cells per well in a six-well plate were transfected with 50 nM siHuR or negative control for 48 h using HiperFect transfection reagent (Qiagen) as described above.

For the luciferase assay, the 3′ UTR of IκBα, including the binding site for miR-19a, was amplified from the MGC-803 cells using the following primers: IκBα, forward 5′-AAGGAGGAGGGCAGAATCAT-3′ and reverse, 5′-ATCTGCATGGTGATGTTGGA-3′. The PCR product was then digested with XbaI (New England Biolabs, Beverly, MA, USA) and cloned into the pGL3 reporter plasmid (Promega Corporation, Madison, WI, USA), downstream of the luciferase reporter gene.

The modified firefly luciferase vector (500 ng/μl) was transfected into HEK293 cells (2×10⁵ cells/ml), as described previously, and firefly and Renilla luciferase activities were measured 48 h after transfection using a Dual-Luciferase Reporter Assay system (Promega Corporation). Firefly activity was normalized to Renilla activity to control the transfection efficiency.

MGC-803 cells were cultured on six-well chamber slides and fixed with 4% paraformaldehyde for 10 min at −20°C. The slides were washed in PBS three times and incubated with a polyclonal antibody against NF-κB (1:50 diluted in PBS with 1% BSA; 50 μl/slide) for 2 h at room temperature. After washing with PBS three times (5 min per time), the slides were incubated with tetramethylrhodamine-conjugated anti-rabbit IgG (Beijing Zhongshan Jinqiao Biotechnology Co., Ltd, Beijing, China; diluted 1:100 in PBS with 1% BSA; 50 μl/slide) for 1 h at room temperature. Three times after washing the slides in PBS, the slides were incubated with Hoechst 33258 (10 μg/ml) for 5 min. The slides were then washed again and examined using a fluorescence microscope (Leica CM3000; Leica Microsystems GmbH, Buffalo Grove, IL, USA).

In order to evaluate the effect of miR-19a on cell proliferation, the cells were seeded at 5,000 cells/well in 100 μl medium in 96-well plates and were transfected with miR-19a mimics or inhibitors (50 nM) or negative control-miRNA mimics (50 nM), as described above. Following transfection, 20 μl MTT reagent (Beijing SolarBio Science & Technology Co., Ltd.) was added to the wells after 24 h and incubated for 4 h at 37°C. Subsequent to removal of the medium, 200 μl dimethyl sulfoxide was added to dissolve the formazan, and the absorbance was measured at 550 nm using a SpectraMax^® M3 (Molecular Devices Inc., Sunnyvale, CA, USA). Wells containing only MGC-803 cells served as blank controls.

Data are presented as the mean ± standard error of three independent experiments. ImageJ software (National Institutes of Health, Bethesda, MD, USA) was used for density analysis. GraphPad Prism (GraphPad, Inc., La Jolla, CA, USA) was used for statistical analyses. Student's t-test was used to assess differences between groups. P<0.05 was considered to indicate a statistically significant difference.

The relative levels of miR-19a in human gastric carcinoma cells were detected using RT-qPCR. Compared with the GES-1 immortalized gastric epithelial cell line, the miR-19a levels were significantly increased (>1-fold) in the MGC-803, BGC-823 and SGC-7901 human gastric carcinoma cell lines, when the miR-19a expression level was normalized to U6 (Fig. 1; P<.05). Based on these results, the levels of miR-19a were significantly increased in human gastric carcinoma cells.

To investigate the effect of miR-19a on MGC-803 cell viability, the MGC-803 cells were transfected with miR-19a mimics, inhibitors or negative controls for 24, 48 or 72 h, respectively. In this investigation, the mimics were analogues that enhanced the expression of miR-19a, whereas the inhibitors were analogues that reduced the expression of miR-19a. The MTT assay demonstrated that, when the miR-19a mimics were transfected into the MGC-803 human gastric carcinoma cell line, cell viability was significantly increased by 23 and 35% at 48 and 72 h, respectively (Fig. 2A). Conversely, when the expression of miR-19a was inhibited, cell viability was reduced by 17 and 36% at 48 and 72 h, respectively (Fig. 2B). These results indicated that miR-19a increased MGC-803 cell viability.

In gastric carcinoma, the NF-κB signaling pathway is constitutively activated. In previous studies, several miRNAs have been reported to activate NF-κB. For example, miR-301a has been demonstrated to target NF-κB-repressing factor and to correlate with abnormal NF-κB activation (17). In the present study, the MGC-803 gastric carcinoma cells were treated with 10 ng/μl TNF-α for 48 h, following which the relative levels of miR-19a were analyzed. As shown in Fig. 3A, the relative levels of miR-19a increased ~4-fold following TNF-α treatment. In addition, western blotting was performed to ascertain whether TNF-α treatment significantly activated the NF-κB signaling pathway. To address whether miR-19a contributes to NF-κB activation, the MGC-803 gastric carcinoma cells were transfected with miR-19a mimics. Based on the results of the western blot analysis, it was concluded that when miR-19a was overexpressed, NF-κB was significantly activated. As shown in Fig. 3A, compared with the negative control, the phosphorylated-NF-κB/NF-κB ratio was increased by >1-fold. Vascular cell adhesion molecule (VCAM), intercellular adhesion molecule (ICAM) and monocyte chemoattractant protein-1 (MCP-1) are among the important adhesion molecules that are aberrantly expressed in various types of cancer (18). To validate the abnormal NF-κB activation, the protein levels of VCAM, ICAM and MCP-1 were measured. As shown in Fig. 3B, their relative levels were all increased ~1-fold. Based on the above results, it was concluded that miR-19a contributed to TNF-α-stimulated NF-κB activation. In order to investigate the effect of NF-κB on cellular proliferation, a small interfering (si)RNA-targeting NF-κB was selected. As shown in Fig. 3C, following knockdown of NF-κB, cell viability was significantly reduced, even in the cells transfected with the miR-19a mimics. The MTT assay demonstrated that cell viability was significantly reduced in the cells transfected with si-NF-κB. These data suggested that miR-19a enhanced cellular proliferation through activation of the NF-κB signaling pathway.

To further confirm that NF-κB was activated upon miR-19a overexpression, immunofluorescence was measured. As shown in Fig. 4A, enhanced NF-κB (p65) protein levels were detected when the MGC-803 cells were transfected with miR-19a mimics. According to TargetScan, miR-19a was predicted to target IκBα. IκB is an NF-κB inhibitory protein (19). In the resting state, IκB-α combines with p65, P50, resulting in the inactivation of NF-κB in the cytoplasm. Through the activation of IKK, IκBα is degraded, which drives the two subunits of NF-κB to translocate between the cytoplasm and the nucleus, particularly the p65 subunit, inducing a downstream signaling pathway. Therefore, the effects of miR-19a on the expression of IκBα were assessed. When the MGC-803 human gastric carcinoma cell line was transfected with miR-19a mimics for 48 h, the density of IκBα was significantly reduced, compared with the negative control (Fig. 4B). Furthermore, 48 h following transfection of the MGC-803 cells with miR-19a, the expression level of IκBα was reduced by 56%. Conversely, when miR-19a was inhibited in the MGC-803 cells, the expression level of IκBα was increased by almost 1-fold (Fig. 4C). A luciferase assay was also performed to detect the effect of miR-19a on the 3′-UTR region of IκBα. As shown in Fig. 4D, miR-19a significantly reduced IκBα-3′-UTR-luciferase reporter activity. Based on the above analysis, it was suggested that miR-19a induced NF-κB activation, predominantly by targeting IκBα, in the human gastric carcinoma cells.