A total of 32 adult male Sprague-Dawley rats weighing 200–250 g, aged 6–8 weeks were provided by the Laboratory Animal Center, Academy of Military Medical Sciences (Beijing, China). The rats were housed in individual cages with free access to food and fresh water, and under conditions of a 12 h/12 h light/dark cycle and a controlled temperature (22–24°C). The experimental animal protocol of the present study was approved by the Ethics Committee of Tianjin First Center Hospital (Tianjin, China) and followed the national and institutional guidelines for animal experiments. Paraquat was purchased from Sigma-Aldrich (St. Louis, MO, USA). The rats in the control group (n=8) were administered with saline. Rats in the treatment group (n=24) were intraperitoneally injected with PQ at a dose of 15 mg/kg per rat. On days 7, 14 and 21 following PQ treatment, the rats were anesthetized by intraperitoneal injection of pentobarbital (20 mg/kg). The lungs were excised and immediately frozen in liquid nitrogen.

The A549 lung cancer cell line were purchased from the American Type Culture Collection (Manassas, VA, USA). Cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen; Thermo Fisher Scientific, Waltham, MA, USA) containing 10% fetal bovine serum (Invitrogen) at 37°C in a humidified atmosphere with 5% CO₂. PQ was diluted with saline solution to obtain various final concentrations (5, 10, 25, 50 and 100 μM), with which A549 cells were treated for 24 h.

To knockdown the expression of TGF-β1, small hairpin (sh)RNA specific for TGF-β1 was constructed and transfected into A549 cells using Lipofectamine™ 2000 (Invitrogen) according to the manufacturer's instructions. The sequences of shRNAwereasfollows:Sense5′-CACCCAGCACGTGGAGCTG TACCAGAAATTTCAAGAGAATTTCTGGTACAGCT CCACGTGCTGTTTTTTG-3′ and antisense 5′-GATCCAAAAAACAGCACGTGGAGCTGTACCAGAAA TTCTCTTGAAAGGGCTGGTACAG CTCCACGTGCTG-3′. The shRNA were synthesized by GenePharma Co., Ltd. (Shanghai, China). Prior to transfection, cells were seeded into six-well plates and allowed to attach for 24 h. 5 μl Lipofectamine™ 2000 and 4 μg TGF-β1-specific shRNA were diluted in 250 μl Opti-Mimimum Essential Medium I (Invitrogen) each. The solutions were mixed and incubated at room temperature for 20 min to form lipid-DNA complexes. Cells were incubated with the lipid-DNA complexes at 37°C for 6 h. Subsequently, the supernatant was replaced with fresh medium and cells were maintained in culture for 24 h.

The left lungs were fixed in 10% paraformaldehyde solution (Beijing Dinguo Chansheng Biotechnology Co., Ltd., Beijing China) de-hydrated and then embedded in paraffin. 4-μm sections were cut and mounted on slides. To remove the paraffin, the slides were immersed in xylene (Guangzhou Xinchenghuagong, Inc., Guangzhou, China) and a graded series of ethanol (Guangzhou Xinchenghuagong, Inc.). Subsequently, the tissue samples were stained with HE (Maixin, Fuzhou, China). The sections were observed and images were captured using a light microscope (E200; Nikon, Tokyo, Japan).

Total protein was extracted from the rat lung tissues and A549 cells using a total protein extraction kit (cat. no. E211-02; Vazyme, Inc., Nanjing, China). Protein concentrations were determined using a bicinchoninic acid kit (cat. no. P0010; Beyotime Institute of Biotechnology, Haimen, China). Protein samples (50 μg) were separated by 10% SDS-PAGE and then transferred onto a nitrocellulose membrane (EMD Millipore Corp., Billerica, MA, USA). The nitrocellulose membrane was blocked with 3% bovine serum albumin (Amresco Inc., Solon, OH, USA) in Tris-buffered saline overnight at 4°C. After washing with phosphate-buffered saline, the membrane was incubated with the following primary antibodies: rabbit polyclonal anti-E-cadherin (cat. no. sc-7870; 1:800), mouse monoclonal anti-vimentin (cat. no. sc-373717; 1:400), rabbit polyclonal anti-TGF-β1 (cat. no. sc-146; 1:400), mouse monoclonal anti-Smad2 (cat. no. sc-101153; 1:200), all from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA), mouse monoclonal anti-α-smooth muscle actin (cat. no. BM0002; 1:500) or rabbit polyclonal anti-GAPDH (cat. no. BA2913; 1:2,000), both from Boster Biological Technology Ltd., (Wuhan, China), overnight at 4°C. The membrane was then incubated with the horseradish peroxidase (HRP)-labeled secondary antibody [goat anti-mouse immunoglobulin (Ig)G-HRP; sc-2005; 1:4,000) or goat anti-rabbit IgG-HRP (cat. no. sc-2004; 1:4,000; Santa Cruz Biotechnology, Inc.) for 2 h at room temperature. The immunoreactive proteins were detected using an enhanced chemiluminescence kit (cat. no. 32209; Pierce Biotechnolgy, Inc., Rockford, IL, USA). GAPDH was used as a loading control. Images of the blots were captured using a ScanJet 4C Flatbed Scanner (Hewlett-Packard, Palo Alto, CA, USA). Densitometric quantification was performed using Image-Pro Plus software (version 6.0; Media Cybernetics, Inc., Rockville, MD, USA).

Values are expressed as the mean ± standard deviation. Two-tailed Student's t-test was used to analyze differences between two groups. SPSS 19.0 statistical software was used (IBM SPSS, Armonk, NY, USA). Data are representative of at least three independent experiments. P<0.05 was considered to indicate a statistically significant difference between values.

In order to identify PQ-induced pulmonary fibrosis, HE staining of lung tissues from PQ-treated rats was performed. As shown in Fig. 1, the lung structure in PQ-treated animals was distorted with severe epithelial degeneration, alveolar disruption, inflammatory cell infiltration and fibrotic invasion at day 7 following PQ treatment, which was further aggravated with increasing time until the end of the experiment on day 21.

To examine the effects of PQ treatment on the EMT in rat lung tissues, the expression of molecular EMT markers, including E-cadherin, α-SMA and vimentin, was detected by western blot analysis. As shown in Fig. 2, the epithelial-cell marker E-cadherin was decreased following PQ treatment as compared with that in the control group, and progressively decreased until the end of the experiment on day 21. By contrast, from day 7 onwards, an increase in the expression of mesenchymal cell markers α-SMA and vimentin was observed.

Next, the present study examined the effects of PQ treatment on the TGF-β/Smad signaling pathway in rat lung tissues. As shown in Fig. 3, western blot analysis indicated that the expression of TGF-β1 and Smad2 was significantly increased on day 7 following PQ treatment (P<0.05) and was further increased on days 14 and 21 (P<0.01).

To investigate the induction of the EMT by PQ in vitro, A549 lung cancer cells were incubated with various concentrations of PQ (5, 10, 25, 50 and 100 μM) for 24 h and the expression of EMT markers was determined by western blot analysis. The results revealed that treatment of A549 cells with PQ resulted in a dose-dependent decrease of E-cadherin expression, while the expression of α-SMA and vimentin was significantly increased in a dose-dependent manner following PQ treatment (Fig. 4).

To clarify the underlying mechanisms of PQ-induced EMT in A549 cells, the present study examined the expression of TGF-β1 and Smad2 in A549 cells following treatment with 100 μM PQ for 24 h. Western blot analysis demonstrated that compared with the control, the expression of TGF-β1 and Smad2 was significantly increased in A549 cells treated with PQ (Fig. 5). Next, TGF-β1 shRNA was transfected into A549 cells to knockdown TGF-β1 expression. Western blot analysis showed that the expression of TGF-β1 and Smad2 was significantly decreased in PQ-untreated A549 cells following TGF-β1 shRNA transfection. PQ-induced upregulation of TGF-β1 and Smad2 was also significantly suppressed by TGF-β1 shRNA (Fig. 6). As shown in Fig. 7, transfection with TGF-β1 shRNA led to an increase in E-cadherin, and a decrease in α-SMA and vimentin expression in PQ-untreated A549 cells. Furthermore, compared with the PQ group, the expression of E-cadherin was significantly increased, while the expression of α-SMA and vimentin was significantly decreased in the PQ + TGF-β1 shRNA group.