Heart tissue samples were collected from patients succumbed to cardiac hypertrophy (n=15; age, 40–86 years; males, n=7; females, n=8) and patients who succumbed to conditions other than cardiac hypertrophy as controls (n=15; age, 32–77 years; males, n=9; females, n=6) at the First Affiliated Hospital of Xinxiang Medical University (Weihui, China). Fresh tissues were obtained with written informed consent from all patients according to protocols approved by Ethical Review Board in the First Affiliated Hospital of Xinxiang Medical University (Weihui, China).

The experimental animal protocol of the present study was approved by the ethics committee of the First Affiliated Hospital of Xinxiang Medical University (Weihui, China). Cardiomyocytes were obtained from 8-week-old Wistar rats (n=9; male; weight, 4–6 g; purchased from Jinfeng Experimental Animal Company, Jinan, China) kept in ventilated housing with 50–60% humidity at 18–22° C following previously described procedures (13). Briefly, the hearts were harvested and homogenized with HEPES (Sigma-Aldrich)-buffered saline following sacrification of the animals by CO₂ aspiration. The heart tissue samples were subsequently treated with 1.2 mg/ml pancreatin and 0.14 mg/ml collagenase (Worthington Biochemical Corporation, Lakewood, NJ, USA) in HEPES-buffered saline. The cells were then resuspended in Dulbecco's modified Eagle's medium/F-12 (Invitrogen Life Technologies, Carlsbad, CA, USA) supplemented with 5% heat-inactivated horse serum (Invitrogen Life Technologies), 0.1 mM ascorbate (Sigma-Aldrich), insulin-transferring-sodium selenite medium (Sigma-Aldrich), 100 U/ml penicillin, 100 µg/ml streptomycin and 0.1 mM bromodeoxyuridine (all from Sigma-Aldrich) at 1×10⁶ cells/ml prior to being plated at 5×10⁵ cells/well and cultured at 37° C for 1 h. Cells were treated with ISO (10 µM; Sigma-Aldrich) and Aldomet (Aldo; 1 µM; Sigma-Aldrich) for the indicated durations (0, 1, 2, 4 or 8 h).

Total RNA was extracted from the coronary tissue samples using TRIzol™ reagent (Sigma-Aldrich, St Louis, MO, USA). The RT reaction was performed using the TaqMan^® MicroRNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Waltham, MA, USA) following the manufacturer's instructions. qPCR was performed using TaqMan^® 2X Universal PCR Master mix (Applied Biosystems) on a CFX96™ Real-Time PCR Detection system (Bio-Rad Laboratories, Hercules, CA, USA) supplied with analytical software. The reactions were incubated in an 9700 Thermocycler (Applied Biosystems) in a 96-well plate for 30 min at 16° C, 30 min at 42° C, 5 min at 85° C and then held at 4° C. The primers are as follows: miR-1, GAGTTGCCTGACTTCT, and TTCAACAGGCCTAGTA (Thermo Fisher, Grand Island, NY, USA); β-myosin heavy chain (β-MHC), CTGGCACCGTGGACTACAAC, and CGCACAAAGTGAGGATAGGGT (Sangon Biotech, Shanghai, China). The ∆∆CT method was used to quantify the abundance of miRNA or mRNA.

A recombinant adenovirus expressing the constitutively active form of NFATC3 (Ad-NFATC3) was obtained from Dr Michael C. Naski (Department of Pathology, University of Texas Health Science Center, San Antonio, TX, USA) (14). An adenoviral vector containing enhanced green fluorescent protein (Ad-EGFP), was provided by Dr Liu (Medical College, Qingdao University, Qingdao, China) (15) using a TCID50 Quick Determination kit (Jimei Biotech, Shanghai, China), and used as a negative control. The propagation and titration of the adenoviruses was performed as previously described (16). The adenoviruses were added to the cultures 48 h prior to the experiments at a multiplicity of infection of 10 and incubated at 37° C for 3 h, following which the adenoviruses were removed by replacing with fresh culture medium.

The cell surface area of the experimental cells was determined based on the fluorescent staining of F-actin in the cardiomyocytes, as previously described (17). Briefly, following the indicated treatments, the cardiomyocytes were fixed with 4% paraformaldehyde and treated with 0.1% Triton X-100. The cells were then incubated overnight with fluorescent phalloidin-tetramethylrhodamine conjugate (Sigma-Aldrich) at room temperature, prior to being visualized using a Zeiss LSM 510 META laser confocal microscope (Zeiss, Oberkochen, Germany). A total of 100 cells were counted in 30–50 randomly-selected fields. The size of the area outlined by F-actin was determined using ImageJ software (version 1.48u; National Institutes of Health, Bethesda, MD, USA). The data are expressed as the mean ± standard deviation.

The evaluation of the protein/DNA ratio in the experimental cardiomyocytes was performed, as described in a previous study (13). Salmon sperm, perchloric acid and KOH were purchased from Shanghai Sangon Biotech. Hoechst dye and human serum albumin were purchased from Sigma-Aldrich.

The procedures used to perform western blotting assays were those previously described (15). Briefly, the total protein was extracted from the cells using PER Mammalian Protein Extraction reagent (200 µl for 1×10⁶ cells; Thermo Fisher Scientific) and the protein concentration was determined using the bicinchoninic acid assay (Invitrogen Life Technologies). A total of 20 µg protein per lane was separated by 10% SDS-PAGE and subsequent transfer onto 0.45-µm nitrocellulose membranes (Millipore, Billerica, MA, USA). The membranes were then blocked with 5% fat-free dry milk and incubated with the indicated primary antibodies (Abs), including GAPDH (D16H11) XP^® rabbit monoclonal Ab (cat no. 5174; 1:1,000; Cell Signaling Technology, Inc., Danvers, MA, USA) and NFATc3 mouse monoclonal Ab (cat no. sc-8405; 1:500, Santa Cruz Biotechnology, Inc., Dallas, TX, USA), overnight at 4° C. After three washes with phosphate-buffered saline containing Tween 20, membranes were incubated with goat anti-rabbit and anti-mouse antibodies (cat. nos. ZDR-5306 and ZDR-5307, respectively; 1:5,000; ZSGB-BIO, Beijing, China) for 1 h. Finally, the blots were visualized using SuperSignal West Dura Extended Duration substrate (Thermo Fisher Scientific, Inc.). ImageJ software was used for quantification of the blots.

The miR-1 and control mimics were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). The cells were transfected with either 300 nM control mimics or 300 nM miR-1 mimics. The experiments described above were performed 48 h post-transfection.

To investigate whether NFATC3 is a target of miR-1, two recombinant vectors were constructed to express luciferase under the regulation of the 3′-UTR of NFATC3 mRNA, containing either wild-type miR-1 MREs or mutant MREs (pMIR-REPORT-NFATC3-wt and pMIR-REPORT-NFATC3-mut, respectively). At 48 h post-transfection with Lipofectamine^® 2000 (Invitrogen Life Technologies), lysis buffer (Promega Corporation, Madison, WI, USA) was added to the cell culture, and the expression of luciferase was detected using a Dual-Luciferase Reporter system (Promega Corp.), according to the manufacturers' instructions.

Statistical significance was calculated using Students' t-test. All statistical analyses were performed using SPSS software version 19.0 (International Business Machines, Armonk, NY, USA). P<0.05 was considered to indicate a statistically significant difference.

Heart tissue samples were obtained from patients suffering from cardiomyocyte hypertrophia (n=15). In addition, cardiac tissue samples obtained from donors without heart diseases, which served as controls (n=15). The expression levels of miR-1 were quantified in the tissue samples, and compared between the two groups. The expression of miR-1 was significantly suppressed in the hypertrophic heart tissue samples, compared with the control group (Fig. 1A).

As miR-1 is aberrantly expressed in human hypertrophic heart tissue samples, the expression levels of miR-1 were also investigated in rat cardiomyocytes. Isolated rat cardiomyocytes were treated with ISO or Aldo, and the expression levels of miR-1 were quantified. The expression levels of miR-1 gradually decreased following each treatment (Fig. 1B and C). Western blotting was used to confirm the reduction in the expression levels of miR-1 induced by ISO or Aldo (Fig. 1D and E).

As the expression levels of miR-1 were found to be reduced in the hypertrophic heart tissue samples, the potential changes in the expression levels of miR-1 were investigated, in order to determine whether the changes in expression levels affected the hypertrophic response of the cardiomyocytes. Synthetic miRNA mimics were then used to restore the expression of miR-1 in the cardiomyocytes pre-treated with ISO or Aldo (Fig. 2A and B). Restoration of the expression of miR-1 was demonstrated to reduce the cell surface area of the cardiomyocytes (Fig. 2C and D). In addition, the ratio of protein to DNA was decreased when miR-1 was overexpressed (Fig. 2E and F), and the mRNA expression levels of β-MHC were also reduced (Fig. 2G and H). These results suggested that miR-1 suppression is required for the pro-hypertrophic activity of ISO and Aldo.

Following establishment of the role of miR-1 in the hypertrophic response of rat cardiomyocytes, the present study investigated the effects of miR-1 silencing on the cardiomyocytes. A synthetic inhibitor specific for miR-1 was used to reduce the expression levels of endogenous miR-1 (Fig. 3A). Following treatment with the inhibitor, the surface area of the cardiomyocytes increased significantly (Fig. 3B), and the protein/DNA ratio (Fig. 3C) and expression of β-MHC also increased (Fig. 3D). These results suggested that silencing of the expression of miR-1 induced cardiomyocyte hypertrophy.

As miR-1 is important in suppressing cardiomyocyte hypertrophy, the present study investigated its underlying molecular mechanisms. Potential targets of miR-1 were screened using the online database, TargetScan (http://www.targetscan.org/). NFATC3, a putative transcription factor that enhances hypertrophic response by promoting the expression of myocardin (18), was among the predicted targets of miR-1. One copy of miR-1 MRE was located within the 3′-UTR of NFATC3 mRNA (Fig. 4A). There was an inverse association between the expression levels of miR-1 and NFATC3 in the human heart tissue samples (Fig. 4B). The expression levels of NFATC3 increased and decreased in the rat cardiomyocytes following miR-1 silencing and overexpression, respectively (Fig. 4C and D). A luciferase reporter assay demonstrated that the suppression of endogenous miR-1 increased the expression levels of luciferase by pMIR-REPORT-NFATC3-wt (Fig. 4E), whereas increased expression of miR-1 reduced the expression levels of luciferase by pMIR-REPORT-NFATC3-wt, but not pMIR-REPORT-NFATC3-mut (Fig. 4F). These results suggested that miR-1 targeted and suppressed the expression of NFATC3.

As NFATC3 was identified as a novel target of miR-1, the present study aimed to establish the role of NFATC3 in the hypertrophic process of miR-1. An adenoviral vector expressing NFATC3 was used to increase the expression levels of NFATC3 in the rat cardiomyocytes (Fig. 4G). The overexpression of NFATC3 eradicated the effects of miR-1 restoration in cardiomyocytes treated with ISO, evidenced by an increased cell surface area (Fig. 4H), protein/DNA ratio (Fig. 4I) and expression of β-MHC (Fig. 4J). These results suggested that the suppression of NFATC3 is required for the anti-hypertrophic effects of miR-1.