All animal experiments were approved by the Ethics Committee on Animal Experiments of Fudan University (Shanghai, China). Two male Sprague-Dawley rats (age, ~12 weeks; weight, 400 g) were used in the present study and were supplied by the Chinese Academy of Sciences (Shanghai, China). Animals were housed with free access to food and water, under a 12-h light/dark cycle with a constant temperature (20–23°C) and humidity (55±5%). The rats were euthanized by cervical dislocation following anesthesia with pelltobarbitalum natricum (50 mg/kg; Shanghai New Asia Pharmaceutical Co., Ltd., Shanghai, China). All lumbar spines were obtained within 1 h of sacrifice, and the discs were carefully dissected under a microscope, in order to obtain only the CEP, which was minced into small pieces (<0.3 mm³) under aseptic conditions. To isolate the chondrocytes, the tissues were sequentially treated with 0.25% trypsin (Sigma-Aldrich, St. Louis, MO, USA) at 37°C for 120 min followed by 0.02% collagenase (Sigma-Aldrich) at 37°C for 24 h. Following enzymatic digestion, the tissues were filtered through a 70-µm mesh cell strainer (Beyotime Institute of Biotechnology, Nantong, China) and were washed with phosphate-buffered saline (PBS). Subsequently, the cells were released from the matrix by centrifugation at 200 × g for 5 min at room temperature, seeded into six-well plates at 2×10⁴ cells/well, and maintained in Dulbecco's modified Eagle medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.), 100 U/ml penicillin and 100 µg/ml streptomycin (Beyotime Institute of Biotechnology) at 37°C in a humidified incubator containing 5% CO₂. Primary chondrocytes were maintained in a high-density monolayer culture for 1 week, and toluidine blue staining (Shanghai Haoran Biotechnology Co., Ltd., Shanghai, China) was used to confirm the chondrocytic phenotype of the cells. The cells were then trypsinized and subcultured into six-well plates, which were used in the subsequent experiments as secondary cells.

After being cultured in either 1 or 10% FBS for 24 h, the cells were treated with a concentration gradient of recombinant CCN3 (rCCN3; Sino Biological Inc., Beijing, China; 0, 0.5, 1 and 2 µg/ml) for 24 h. Subsequently, apoptosis was determined by staining with annexin V fluorescein isothiocyanate (FITC) and propidium iodide (PI) (BD Pharmingen, San Diego, CA, USA), according to the manufacturer's protocol. To quantify apoptosis, the cells were washed with cold PBS and suspended in binding buffer. The cells were then stained with 5 µl annexin V-FITC and 5 µl PI at 4°C for 15 min, and were analyzed using FACScan flow cytometry (BD Biosciences, San Jose, CA, USA) (22). The cells were quantified as follows: i) Annexin V negative/PI negative (viable cells); ii) annexin V positive/PI negative (cells in the initial stages of apoptosis); iii) annexin V positive/PI positive (cells in the advanced stages of apoptosis); and iv) annexin V negative/PI positive (necrotic cells).

RT-qPCR was performed to detect the mRNA expression levels of CCN3 in cells cultured with 1 or 10% FBS at 24, 36 and 48 h. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used as an internal standard control. In addition, after treating cells with 1 µg/ml rCCN3, the mRNA expression levels of aggrecan, collagen II and CCN2 were assessed by RT-PCR at 8 and 24 h. Total RNA was extracted from the cells using TRIzol^® reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Single-strand cDNA templates were prepared from 1 µg total RNA using the RT-for-PCR kit (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's instructions. Specific cDNAs were subsequently amplified by PCR using the following primers (Shanghai R&S Biotechnology Co., Ltd., Shanghai, China): Aggrecan, forward CAGAAAAACAGACTGAATGGGA, reverse GCAAGTGAAGGTGTGTATGGC; collagen II, forward GCAAGAATCCCGCTCGCA, reverse TGGGTTGGGGTAGACGCA; CCN3, forward GCCCTTCCAGCCTACAGACC, reverse GGTGGATGGATTTCAGGGACT; CCN2, forward GCTAATGGTGGACCGCAA, reverse CCAAGGTAACGCCAGGAAT; and GAPDH, CCCCAATGTATCCGTTGTG, and reverse CTCAGTGTAGCCCAGGATGC. PCR amplification from cDNA was performed using the Takara TP800 Thermal Cycler Dice (Takara Bio Inc., Shiga, Japan) in a final volume of 20 µl [2X SYBR Green mix (10 µl; Toyobo Co., Ltd., Tokyo, Japan) 1 µl primer mix, 1 µl template DNA and 8 µl diethypyrocarbonate water] under the following cycling conditions: Initial denaturation at 95°C for 2 min, denaturation at 95°C for 15 sec, annealing at 59°C for 20 sec, elongation at 72°C for 20 sec and final extension at 72°C for 10 min; the optimal cycle number was 40 cycles. PCR products were subjected to amplification curve analysis and were quantified using SYBR Green (Invitrogen; Thermo Fisher Scientific, Inc.). The data were normalized to GAPDH and were presented as ΔΔCt (22).

Cells cultured in 1% FBS were treated with 0 or 2 µg/ml rCCN3 for 24 h, and control group cells were cultured in 10% FBS only. The protein expression levels of Fas, B-cell lymphoma 2 (Bcl-2) and Bcl-2-associated X protein (Bax) were detected in the three groups by western blot analysis, according to the manufacturer's protocol. Total protein was extracted from the cells using protein loading buffer, and the total protein concentration was determined by bicinchoninic acid assay (Sigma-Aldrich). Protein extracts were separated by 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and were transferred to polyvinylidene difluoride membranes (Millipore, Bedford, MA, USA). The membranes were then blocked with 5% non-fat dry milk in Tris-buffered saline with 0.1% Tween (TBST) for 1 h at 37°C, and incubated overnight at 4°C in TBST with polyclonal goat anti-Fas (dilution 1:200; Sigma-Aldrich; cat. no. SAB2501317), rabbit anti-Bcl-2 (dilution 1:500; cat. no. AB112; Beyotime Institute of Biotechnology), mouse anti-Bax (dilution 1:500; cat. no. AB026; Beyotime Institute of Biotechnology) and mouse monoclonal anti-β-actin (dilution 1:2,000; cat. no. AF0003; Beyotime Institute of Biotechnology) antibodies. Following further incubation with a horseradish peroxidase-conjugated goat anti-rabbit IgG secondary antibody (dilution 1:5,000; cat. no. A0208; Beyotime Institute of Biotechnology) for 1 h at room temperature, the membranes were treated with Electrochemiluminescence Plus (Tanon Science & Technology Co., Ltd., Shanghai, China), according to the manufacturer's protocol. β-actin was used as a control to verify equal protein loading.

All measurements were carried out using the same instrument under the same experimental conditions, and were independently performed at least three times to ensure consistency. Statistical analyses were performed using SPSS 16.0 software (SPSS, Inc., Chicago, IL, USA). Data are expressed as the mean ± standard deviation. Significant differences were analyzed by one-way analysis of variance among the groups and Student's t-test. P<0.05 was considered to indicate a statistically significant difference.

Toluidine blue staining was used to confirm the phenotype of cells cultured from the CEP. The cells were observed to be viable and possessed characteristic features of chondrocytes, as evidenced by typical cell morphology and ECM staining (Fig. 1A).

To investigate whether serum deprivation regulates CCN3 expression, RT-qPCR was used to quantify the mRNA expression levels of CCN3 in cells cultured in 1 or 10% FBS. As shown in Fig. 1B, the mRNA expression levels of CCN3 in the serum deprivation group were markedly increased, as compared with in the control group at 24, 36 and 48 h. A marked increase was detected at 48 h in the serum deprivation group; however, no obvious difference in the expression of CCN3 was detected in the serum-deprived cells between 24 and 36 h.

To determine whether exogenous rCCN3 had an effect on the apoptosis of CEP cells, the apoptotic rate of cells stained with annexin V-FITC and PI were quantitatively assessed following treatment with a concentration gradient of rCCN3 for 24 h. As shown in Fig. 2, a dose-dependent increase of apoptosis was detected in the 1% FBS groups (13.28±0.52, 15.86±0.58, 18.34±0.63 and 23.78±0.64%, respectively), whereas rCCN3 did not exert a proapoptotic effect on cells cultured in 10% FBS (4.22±0.24, 4.35±0.34, 4.26±0.30 and 4.75±0.42%, respectively).

To explore the mechanism underlying the proapoptotic effects of rCCN3, Fas, Bax and Bcl-2 expression levels were detected by western blot analysis in cells cultured under 1 or 10% FBS with or without rCCN3 (Fig. 3). The results demonstrated that Fas expression was markedly upregulated following serum deprivation with or without rCCN3 at 24 h, and no obvious variation was detected following treatment with 2 µg/ml rCCN3. Furthermore, Bax expression was also markedly increased, whereas Bcl-2 expression levels were decreased in the cells under serum deprivation conditions, as compared with the cells in the 10% FBS group. Notably, the results also demonstrated that Bax and Bcl-2 were affected by exogenous rCCN3 treatment. The differences in Bax and Bcl-2 were investigated and found to be consistent with the effects on apoptosis following treatment with rCCN3. These results suggest that rCCN3 may regulate cellular apoptosis under serum deprivation conditions, and the mitochondrial apoptotic pathway may be responsible for increased cellular apoptosis under serum deprivation conditions.

Finally, the effects of rCCN3 treatment on the expression levels of critical ECM genes were determined by RT-qPCR in CEP cells cultured under normal or serum deprivation conditions. Treatment with rCCN3 decreased the expression levels of aggrecan and collagen II under both normal and serum deprivation conditions at 8 and 24 h, and a more obvious difference was detected under serum deprivation conditions (Fig. 4A and B). Furthermore, the mRNA expression levels of CCN2 were decreased following treatment with rCCN3, whereas a decrease in CCN2 expression was not as apparent in the 1% FBS group (Fig. 4C). These findings indicate that CCN2 expression may also be influenced by serum deprivation.