The ARPE-19 human RPE cell line was purchased from the American Type Culture Collection (Manassas, VA, USA). The cells were cultured in Dulbecco's modified Eagle medium (DMEM) supplemented with 10% heat-inactivated fetal bovine serum (FBS) (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA), 100 µg/ml streptomycin and 100 U/ml penicillin (CSPC Pharmaceutical Group Ltd., Shijiazhuang, China) at 37°C in an atmosphere containing 5% CO₂. The cells were passaged every 3 days once grown to ~90% confluence.

ARPE-19 cells were grown to 80% confluence, and were treated with H₂O₂ (250 or 500 µM; Sigma-Aldrich, St. Louis, MO, USA) for 12 or 24 h following supplementation with allicin (5, 10, 20 or 40 µg/ml; 98% purity; Shaanxi Ciyuan Biotech Co., Ltd., Xian, China) for 4 h. Cells were harvested after the appropriate treatments. Cell viability was measured using a 3-(4,5-dimethylthiazol-2-yl)-2,5-di-phenyl tetrazolium bromide (MTT) assay (Sigma-Aldrich). Briefly the cells were incubated with 50 µl MTT at 37°C for 4 h. Subsequently, the MTT-containing medium was discarded and 200 µl dimethyl sulfoxide was added to the cells, in order to dissolve the formazan crystals. Optical densities (OD) were measured at 450 nm using a VersaMax microplate reader (Molecular Devices, Sunnyvale, CA, USA). Viability was calculated as OD value/cell number; untreated ARPE-19 cells (control group) were denoted as 100% viable.

An Intracellular ROS Assay kit (Cell Biolabs, Inc., San Diego, CA) was used to detect the intracellular ROS levels. Briefly, 100 µl 2′,7′-dichlorodihydro fluorescein diacetate (DCFH-DA) was added to the culture media of the ARPE-19 cells for 30 min at 37°C. Subsequently, the cells were washed twice with phosphate-buffered saline (PBS). DCFH fluorescence of the cell lysate was measured at an excitation wavelength of 485 nm and an emission wavelength of 535 nm using a FLUOstar optima (BMG LABTECH, Inc., Cary, NC, USA), and was quantified using ImageJ version 1.41 software (National Institutes of Health, Bethesda, MD, USA). The average fluorescence intensity was analyzed from five fields for each treatment. The relative fluorescence intensity was expressed as a percentage increase with reference to the intensity of the normal control cells. The glutathione (GSH)/glutathione disulfide (GSSG) ratio and malondialdehyde (MDA) concentrations were assessed using the GSH/GSSG Assay kit (Beyotime Institute of Biotechnology, Nantong, China) and the MDA Assay kit (Nanjing Jiancheng Biological Engineering Institute, Nanjing, China), according to the manufacturer's protocols. The superoxide dismutase (SOD) activity was measured using the SOD Assay kit (Nanjing Jiancheng Biological Engineering Institute), according to the manufacturer's protocols (16).

Total RNA was extracted from the ARPE-19 cells using the RNeasy kit (Qiagen, Inc., Valencia, CA), and first-strand cDNA was synthesized using reverse transcription (RT) reagents (Takara Bio, Inc., Otsu, Japan) and SuperScript III (Invitrogen; Thermo Fisher Scientific, Inc.). RT was conducted in a total volume of 10 µl containing 1 µl RNA, which had been treated with 1 µl RNase inhibitor (Promega Corporation, Madison, WI, USA). RT-qPCR was performed using an Applied Biosystems 7500 system (Applied Biosystems; Thermo Fisher Scientific, Inc.) and SYBR Premix Ex Taq kit (Takara Bio, Inc.). The PCR cycling conditions were as follows: 95°C for 10 min, followed by 45 cycles at 95°C for 10 sec, 57°C for 30 sec and extension at 75°C for 10 sec, and a final 5 min extension step. The primer sequences used were as follows: NADPH oxidase 4 (NOX4), forward tatccagccttccgttggtt, reverse ctgaggtacagctggatgttga; Nrf2, forward gagaagtaccaggaggcgttg, reverse gagccttggacaccaacagat; glyceraldehyde 3-phosphate dehydrogenase (GAPDH), forward ggagtcaacggatttggtc and reverse ggaatcattggaacatgtaaac (Sangon Biotech Co., Ltd., Shanghai, China). GAPDH was used as an internal control. Data were analyzed using the 2^−∆∆Cq method of relative quantification (17).

The ARPE-19 cells were harvested at times appropriate to the indicated treatments. The cells were washed twice with PBS and were then lysed in order to extract the proteins. The nuclear proteins were extracted as previously described (18). Subsequently, the protein samples were isolated using a Protein Extraction kit (Qiagen GmbH, Hilden, Germany) and were quantified with a Bio-Rad Protein Assay (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The protein samples (30 µg) were then separated by 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and were transferred to nitrocellulose membranes (EMD Millipore, Bedford, MA, USA). The membranes were blocked for non-specific binding using 2% bovine serum albumin (Sigma-Aldrich) at 4°C overnight. Subsequently, the membranes were incubated with primary antibodies at 4°C overnight, and appropriate horseradish-peroxidase-conjugated secondary antibodies at room temperature for 1 h (1:500; cat. no. MA1-10371; Thermo Fisher Scientific, Inc.). Signals were acquired using the Enhanced Chemiluminescence Detection system (SuperSignal West Femto; Pierce; Thermo Fisher Scientific, Inc.). Western blotting images from three independent experiments were scanned and quantified using ImageJ version 1.41 software (National Institutes of Health). Band intensities were assessed and normalized to the β-actin bands or Lamin B bands as indicated. The specific primary antibodies used were as follows: Anti-NOX4 (1:400; cat. no. HPA015475; Sigma-Aldrich), anti-NAD(P)H dehydrogenase quinone 1 (NQO1) (1:300; cat. no. N5288; Sigma-Aldrich), anti-Nrf2 (1:500; cat. no. 12721; Cell Signaling Technology, Inc., Danvers, MA, USA), anti-β-actin (1:1,000; cat. no. AV40173, Sigma-Aldrich) and anti-Lamin B (1:400; cat. no. SAB1306342; Sigma-Aldrich) antibodies.

The ARPE-19 cells were cultured in 96-well plates at a density of 2 × 10⁴ cells/well. Non-targeting small interfering (si)RNA (final concentration 50 nM; Ambion; Thermo Fisher Scientific, Inc.) was used as a negative control. Human Nrf2 gene was silenced using Nrf2-specific siRNA (final concentra tion 30 nM) (Ambion; Thermo Fisher Scientific, Inc.). The cells were transfected using siPORT Amine transfection reagent (Ambion; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol (19). Following transfection for 12 or 24 h, the expression levels of Nrf2 were determined by western blotting.

Data are presented as the mean ± standard error of the mean. Student's t-test was used to analyze differences between two groups. The experimental results were analyzed using one-way analysis of variance to compare the differences between three or more groups. Statistical analyses were conducted using SPSS 17.0 software (SPSS, Inc., Chicago, IL, USA). All the experiments were performed at least in triplicate. P<0.05 was considered to indicate a statistically significant difference.

In order to characterize the effects of allicin on H₂O₂-induced damage in RPEs, the cells were exposed to 250 or 500 µM H₂O₂ for 12 or 24 h, following preincubation with various doses of allicin (0, 5, 10, 20 or 40 µg/ml) for 4 h. Viability of the RPEs was assessed using an MTT assay. Treatment with H₂O₂ resulted in a significant loss of cell viability after 12 or 24 h exposure (Fig. 1). Notably, treatment with allicin reversed the effects of H₂O₂ on RPEs. As shown in Fig. 1A, the effects of allicin at various concentrations (5, 10, 20 or 40 µg/ml) were determined following 12 h 250 µM H₂O₂-induced loss of viability. The percentage of viable cells was increased in response to 10–40 µg/ml allicin in a dose-dependent manner (P<0.05). These results suggest that allicin may suppress the loss of cell viability induced by 250 µM H₂O₂. Furthermore, allicin exerted a significant protective effect against 12 h 500 µM H₂O₂-induced damage when administered at a concentration of 20 µg/ml (P=0.039) or 40 µg/ml (P=0.032) (Fig. 1A). Following treatment with 250 µM H₂O₂ for 24 h, allicin significantly attenuated the damaging effects on RPEs when administered at 10 µg/ml (P=0.040), 20 µg/ml (P=0.008) or 40 µg/ml (P=0.004). However, the protective effect of allicin reached a plateau when the concentration of allicin was increased to 20 µg/ml (Fig. 1B). In addition, allicin exerted protective effects against 24 h 500 µM H₂O₂-induced damage. These results suggest that allicin may protect RPEs from H₂O₂-induced damage.

Oxidative stress is characterized by a pathological state of excessive ROS production or abnormal ROS homeostasis (6,20). The present study detected a protective role for allicin with regards to combating H₂O₂ stimulation in RPEs. Therefore, the present study aimed to determine whether allicin suppressed the H₂O₂-induced loss of cell viability by targeting ROS. The effects of allicin on intracellular ROS levels in RPEs were determined using the DCFH-DA assay. Allicin (10 and 20 µg/ml) markedly reduced intracellular ROS levels (P=0.047 and P=0.033), as compared with in the cells not treated with allicin (Fig. 2A). The GSH/GSSG ratio reflects the extent of oxidative stress in cells (21). In the present study, RPEs preincubated with allicin (10 µg/ml, P=0.037; 20 µg/ml, P=0.007) were better at combating H₂O₂ injury, as compared with cells in the H₂O₂ group (Fig. 2B). MDA levels are considered a biomarker of oxidative stress (22). The present study measured MDA levels in the ARPE-19 cells following H₂O₂ stimulation and allicin preincubation (0, 10 and 20 µg/ml). Treatment with H₂O₂ resulted in a significant increase in MDA levels, which was downregulated following allicin preincubation in a dose dependent manner, especially when administered at 20 µg/ml (P=0.027) (Fig. 2C).

The present study detected the expression levels of NOX4, which is the key enzyme of the ROS generation system (23,24), SOD, which is an important biomarker of oxidative stress (25), and NQO1, which is an important antioxidant enzyme (26). Treatment with allicin (20 µg/ml) significantly downregulated the mRNA and protein expression levels of NOX4 (mRNA, P=0.031; protein, P=0.003) following exposure of the cells to 250 µM H₂O₂ for 24 h (Fig. 3A–C). H₂O₂ significantly inhibited the levels of SOD, and pretreatment with allicin significantly attenuated this inhibition when administered at a concentration of 20 µg/ml (P=0.009; Fig. 3D). In addition, allicin was able to markedly increase the protein expression levels of NQO1 when administered at a concentration of 10 µg/ml or 20 µg/ml (P<0.001; Fig. 3B and E).

To further understand the protective effects of allicin against H₂O₂-induced damage, the expression levels of Nrf2, which has an essential role eliminating oxidants by reinforcing cellular antioxidant capacity, were detected (27). As shown in Fig. 4A, the relative mRNA expression levels of Nrf2 were enhanced by allicin in a dose-dependent manner (P<0.05), as compared with the H₂O₂-treated control cells. Furthermore, the cytosolic and nuclear protein expression levels of Nrf2 were detected by western blotting. The cytosolic protein expression levels of Nrf2 were significantly increased following treatment with 20 µg/ml allicin (P=0.008; Fig. 4B and C). Furthermore, the nuclear protein expression levels of Nrf2 were significantly elevated following treatment with allicin at both 10 µg/ml (P=0.025) and 20 µg/ml (P=0.008), as compared with the control cells (Fig. 4D and E). Therefore it was hypothesized that Nrf2 may be associated with the allicin-mediated protection of cells against H₂O₂-induced injury. To verify this hypothesis, differences in the viability of RPEs with or without Nrf2 knockdown were detected in the presence of H₂O₂ and allicin. As presented in Fig. 4F the Nrf2-siRNA effectively silenced Nrf2 gene expression in the RPEs. Nrf2 knockdown significantly attenuated the protection of allicin against H₂O₂-mediated loss of viability (P=0.032). However, Nrf2 knockdown did not completely suppress the protective effects of allicin (Control group 53.34±5.01% vs. 20 µg/ml + knockdown group 63.06±7.85%) (Fig. 4G). These data suggest that allicin may exert protective effects against H₂O₂-induced damage in RPEs not only via regulation of ROS-associated enzymes but also by elevating the activity of the antioxidant Nrf2.