Human prostate carcinoma cells PC3 (CRL-1435) were purchased from the American Type Culture Collection (Manassas, VA, USA) and were maintained in RPMI 1640 media (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (FBS; Invitrogen; Thermo Fisher Scientific, Inc.) at 37°C in a 5% CO₂ incubator. Lycopene (Sigma-Aldrich, St. Louis, MO, USA) was dissolved in tetrahydrofuran (Sigma-Aldrich) as 20 mM stock solution and maintained at −20°C. For the experiments, PC3 cells were cultured in serial concentrations of lycopene (10, 20 and 50 µm) and control cultures were treated with water only.

Total RNA was isolated from cells using TRIzol^® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. For miR-let-7f-1 detection, miRNA was polyadenylated and reverse transcribed into cDNA with the One Step PrimeScript miRNA cDNA Synthesis kit (Takara Biotechnology, Co., Ltd., Dalian, China) in triplicate. For AKT2 detection, cDNA (50 ng) was synthesized using the PrimeScript RT reagent kit (Takara Biotechnology, Co., Ltd.) according to the manufacturer's protocol. RT-qPCR analysis was performed with SYBR Green (Takara Biotechnology, Co., Ltd.) in an ABI 7500 Fast Real-Time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). The small nuclear RNA U6 and glyceraldehyde 3-phosphate dehydrogenase (GAPDH) mRNA were used as internal controls for miRNA and mRNA detection, respectively. The forward primers for the miR-let-7f-1 and U6 were synthesized by Biosune Co., Ltd. (Shanghai, China), and the sequences were as follows: miR-let-7f-1, 5′ CTATACAATCTATTGCCTTCCC 3′ and U6, 5′ TGCGGGTGCTCGCTTCGGCAGC 3′. The reverse primers for the miR-let-7f-1 and U6 were universal adaptor primers available in a ready-to-go format in the One Step PrimeScript miRNA cDNA Synthesis kit (D350A; Takara Biotechnology, Co., Ltd). The primers for the AKT2 and GAPDH genes were obtained from Primerbank (http://pga.mgh.harvard.edu/primerbank/) and the sequences were as follows: AKT2, forward 5′-AGGCACGGGCTAAAGTGAC-3′ and reverse 5′-CTGTGTGAGCGACTTCATCCT-3′; and GAPDH, forward 5′-CTGGGCTACACTGAGCACC-3′ and reverse 5′-AAGTGGTCGTTGAGGGCAATG-3′. The ΔΔCq method (26) was used in the analysis of the PCR data.

miR-let-7f-1 mimics, miR-let-7f-1 inhibitors (anti-miR-let-7f-1) and their corresponding controls, scramble and negative controls (NC), respectively, were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). Cells were transfected with 50 nM oligonucleotides using Superfect™ Transfection Reagent (Qiagen, Inc., Valencia, CA, USA) according to the manufacturer's instructions. Subsequent to 48 h transfection, cells were harvested and the miR-let-7f-1 expression level was confirmed by RT-qPCR.

Following 24 h cultivation, cells were transfected with 50 µm lycopene. To measure the effect of miR-let-7f-1 mimics or lycopene on cell proliferation, cells (2×10³) were incubated in 96-well plates in 100 µl medium containing 10% FBS. A total of 10 µl WST-1 (Roche Diagnostics GmbH, Mannheim, Germany) was added to each well at the indicated time points and the plate was incubated for another 2 h at 37°C. The absorbance was measured at 450 nm using a microtiter plate reader (Spectra Rainbow; Tecan Group Ltd., Männedorf, Switzerland) according to the manufacturer's instructions. Relative optical density was calculated using a Spectra Rainbow microplate reader (Tecan Group, Ltd., Männedorf, Switzerland) in three independent experiments.

Cell apoptosis assay was determined using the Annexin V-Fluorescein Isothiocyanate (FITC) Apoptosis Detection kit (BD Pharmingen, San Diego, CA, USA) according to the manufacturer's instructions. PC3 cells treated as indicated were harvested and resuspended in 100 µl annexin V-FITC labeling solution containing 5 µl annexin V-FITC and 5 µl propidium iodide (BD Pharmingen) and incubated for 30 min at room temperature in dark. Subsequent to incubation, the samples were analyzed by the FC500 Flow Cytometer (Beckman Coulter, Inc., Miami, FL, USA). Each measurement was performed in quadruplicate and each experiment was repeated at least three times.

Whole cell protein lysates were extracted using radioimmunoprecipitation assay buffer (Thermo Fisher Scientific, Inc.) containing 200 ml Na₃VO₄, 200 mM NaF, 0.5 M ethylenediaminetetraacetic acid and proteinase inhibitors, for 30 min on ice. The protein concentrations were quantified with Bio-Rad protein assay reagent (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Equal amounts of proteins (40 µg) were separated by 10% sodium dodecyl sulfate-polyacrylimide gel electrophoresis (Bio-Rad Laboratories, Inc.) and transferred onto polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA), which were incubated with primary monoclonal antibodies against rabbit AKT2 (1:1,000; 2964), mouse phosphorylated AKT2 (Ser474) (1:1,000; 12694; both Cell Signaling Technology, Inc., Danvers, MA, USA) and rabbit GAPDH (1:1,000; sc-47724; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, USA) at 4°C overnight. The membranes were washed 3 times in Tris-buffered saline with Tween-20 (TBST) and incubated with the corresponding horseradish peroxidase-conjugated secondary bovine anti-mouse (sc-2371)and anti-rabbit (sc-2370) IgG antibodies, (both 1:1,000, Santa Cruz Biotechnology, Inc.) for 1 h at room temperature. Subsequent to three washes with TBST, the bound secondary antibody was detected using an enhanced chemiluminescence system (Pierce Biotechnology, Inc., Rockford, IL, USA). The signals were detected using a SuperSignal Protein Detection kit (Pierce Biotechnology, Inc.). The band density of specific proteins was quantified subsequent to normalization with the density of GAPDH using ImageJ (version 1.48; National Institutes of Health, Bethesda, MA, USA.

In silico analyses were performed to determine the putative miRNAs able to target AKT2. TargetScan 6.2 software (http://www.targetscan.org) was used and the 3′ untranslated region (UTR) target regions were selected in order to determine miRNA recognition elements which were involved in cell proliferation.

The full length 3′UTR of the AKT2 gene was PCR-amplified from genomic DNA and inserted into the XhoI and NotI sites of the psi-CHECK2 vector (Promega Corporation, Madison, WI, USA), downstream of the luciferase gene, to generate the plasmids AKT2-UTR-WT. The sequences of primers used were: Forward 5′-AAACTCGAGGCAGTCTGCCCACGCAGA-3′ and reverse 5′-AAAGCGGCCGCCAGGACTGCTGGTAGCACCA-3′. AKT2-UTR-MUT plasmids were generated from AKT2-UTR-WT by mutating the miRNA binding site using a Quick Change Site-Directed Mutagenesis kit (Stratagene; Agilent Technologies, Inc., Santa Clara, CA, USA) with the following primers: 5′-TGGGCACAGGCCTGGCGGGGTCATCTTTTTAGTGCCTCTC-3′ (forward) and 5′-GAGAGGCACTAAAAAGATGACCCCGCCAGGCCTGTGCCCA-3′ (reverse). All constructs were verified by sequencing.

For the luciferase reporter assay, PC3 cells were cultured in 96-well plates and incubated at 37°C for 24 h prior to transfection. Luciferase reporter constructs and miR-let-7f-1 mimics or miR-let-7f-1 inhibitors were transfected using Superfect™ transfection reagent (Qiagen, Inc.). Luciferase activity was measured using the Dual Luciferase Reporter Assay System (Promega Corporation) 48 h post-transfection. Renilla luciferase activity was normalized to firefly lucif-erase activity. All transfection experiments were conducted in triplicate and repeated 3 times independently.

Data were expressed as the mean ± standard deviation of at least three independent experiments. Statistical analyses were analyzed using Student's two-tailed t-test. All analyses were performed with SPSS software, version 15.0 (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.

Previous reports have demonstrated that lycopene was able to inhibit the growth of human colon cancer cells and breast cancer cells by altering PI3K/Akt signaling pathways (27–29), which served a central role in the promotion of cell proliferation and the inhibition of cell death (30,31). We investigated whether the expression of AKT2 was reduced by lycopene. As indicated in Fig. 1, lycopene reduced the expression of AKT2 in a time- and dose-dependent manner at mRNA and protein levels. The mRNA levels of AKT2 in the PC3 cells were reduced by 19, 42 and 67% in response to treatment with 10, 25 and 50 µM lycopene at 48 h compared with the control (Fig. 1A, upper panel). Meanwhile the protein levels of AKT2 and phosphorylated AKT2 in the PC3 cells were significantly reduced by 18, 42 and 52% following treatment with 10, 25, and 50 µM lycopene at 48 h (Fig. 1A, lower panel). Treatment of PC3 cells with 25 µM lycopene for 24 h or 48 h also significantly reduced AKT2 mRNA expression levels by 29 and 49% (Fig. 1B, upper panel) and protein levels by 19 and 38% (Fig. 1B, lower panel).

It is known that that miRNAs exert their biological functions by binding to the 3′-UTR and inhibiting expression of their target genes (9). For this reason, bioinformatics were used to predict the potential miRNAs targeting AKT2. By searching TargetScan, AKT2 was identified as the target of miR-let-7f-1 with the highest possibility.

To confirm the negative regulation of miR-let-7f-1 on AKT2, the 3′-UTR of AKT2 was cloned into a luciferase reporter construct (Fig. 2A). The reporter assay indicated that overexpression of miR-let-7f-1 triggered a marked reduction of luciferase activity of the AKT2-UTR-WT plasmid by 54% in PC3 cells compared with the scramble control, without alteration in luciferase activity of AKT2-UTR-MUT (Fig. 2B). By contrast, inhibition of miR-let-7f-1 dramatically led to a marked increase of luciferase activity of AKT2-UTR-WT by 91%, without alterations in luciferase activity of AKT2-UTR-MUT (Fig. 2C). Consistent with the reporter assay, a significant reduction of AKT2 mRNA by 50% was observed in miR-let-7f-1-overexpressed cells compared with the scramble control in PC3 cells (Fig. 2D). Furthermore, western blot analysis demonstrated that overexpression of miR-let-7f-1 following administration of 10, 20 and 50 nM miR-let-7f-1 mimics was able to downregulate the expression of AKT2 and phosphorylated AKT2 by 35, 45 and 66%, respectively (Fig. 2E). miR-let-7f-1 knockdown at 10, 25 and 50 nm anti-miR-let-7f-1 treatment resulted in a marked increase in AKT2 and phosphorylated AKT2 expression by 42, 69 and 88%, respectively, as compared with the NC group (Fig. 2F). These data indicate that AKT2 is likely to be regulated by miR-let-7f-1 in prostate cancer at transcriptional and post-transcriptional levels.

Previous studies have demonstrated that miR-let-7f-1 was involved in the suppression of cell proliferation (19,20), thus it is hypothesized that the expression of miR-let-7f-1 is augmented by lycopene in PC3 cells. In order to test whether lycopene induced the upregulation of miR-let-7f-1, miR-let-7f-1 expression was detected by RT-qPCR in PC3 cells treated with lycopene. The RT-qPCR assay indicated that the expression of miR-let-7f-1 was enhanced by 74, 131 and 188% in response to lycopene treatment at 10, 25 and 50 µM, in a dose-dependent manner (Fig. 3A). A significant increase of 69 and 151% in miR-let-7f-1 expression was also observed in response to 25 µm lycopene treatment at 24 and 48 h, in a time-dependent manner (Fig. 3B). In order to investigate the role of miR-let-7f-1 in prostate cancer cells, miR-let-7f-1 mimics were transfected into PC3 cells. A proliferation assay was performed to evaluate cell growth and the data demonstrated that the increased expression of miR-let-7f-1 induced significant inhibition on cell proliferation by 7, 20 and 32% at days 1, 2 and 3, respectively (Fig. 3C). Apoptosis assays demonstrated that PC3 cells that were transfected with miR-let-7f-1 mimics exhibited an increase in the apoptotic rate by 200%, as compared with those of the scramble controls (Fig. 3D). These data indicated that miR-let-7f-1 induced by lycopene may effectively inhibit the growth and enhance apoptotic levels of PC3 cells in vitro.

To further confirm that lycopene downregulated the expression of AKT2 by upregulation of miR-let-7f-1, PC3 cells were treated 50 µM lycopene, followed by transfection with 50 nM anti-miR-let-7f-1 oligonucleotides for 48 h. Using the WST-1 assay, it was demonstrated that anti-miR-let-7f-1 attenuated the inhibition of cell proliferation caused by lycopene in PC3 cells by 18, 21 and 28% by days 1, 2 and 3, respectively (Fig. 4A). In addition, knockdown of miR-let-7f-1 in PC3 cells incubated with lycopene resulted in significantly reduced cell apoptosis (47%; Fig. 4B), indicating reversal of the increased effects of lycopene on PC3 cell apoptosis. In addition, anti-miR-let-7f-1 oligonucleotides partly abolished the inhibitory effect of lycopene on AKT2 and phosphorylated AKT2 protein expression (96%; Fig. 4C). Thus, it was confirmed that miR-let-7f-1 was a key mediator of growth inhibition and apoptotic enhancement of lycopene in prostate cancer.