The U937 (CRL-2367™), HL-60 (CCL-240™), MV4-11 (CRL-9591™), M2R (ABT-737 resistant MV4-11), K562 (CCL-243™) and DAMI (CRL-9792™) leukemia cell lines were purchased from the American Type Culture Collection (Manassas, VA, USA). The CCRF and Raji leukemia cell lines were a kind gift from Professor Jianrong Wang at Cyrus Tang Blood Hematology Center of Soochow University (Soochow, China). All cells were cultured in RPMI 1640 (Hyclone; GE Healthcare, Little Chalfont, UK) containing 10% fetal bovine serum (FBS; Hyclone) in a humidified incubator (Midi40; Thermo Fisher Scientific, Waltham, MA, USA) containing 5% CO₂ at 37°C.

Bone marrow samples were collected from 87 AL patients at the Blood Center of the Children's Hospital of Soochow University (Suzhou, China) from December 2010 to January 2013. The patients' bone marrow mononuclear cells (BMNCs) were used in the present study, which were isolated using Ficoll solution. Patients were diagnosed with AL using combined analysis of morphology, immunology, cytogenetics and molecular biology (MICM) (26). Leukemic fusion genes, including those for mixed lineage leukemia (MLL), were detected by RT-PCR. A total of 38 male and 17 female patients with a median age of 5 years (range, 0.1–13.6 years) and a median white blood cell (WBC) count of 50.74×10⁹/l (range, 2.1–638×10⁹/l) were diagnosed with ALL. Furthermore, 17 male and 15 female patients were diagnosed with acute myeloid leukemia (AML) and had a median age of 6.55 years (range, 0.1–13 years) and a median WBC count of 43.78×10⁹/l (range, 1.8–598.9×10⁹/l). In addition, normal bone marrow samples of 29 males and 14 females were collected from the Surgical Department of the Children's Hospital of Soochow University (Suzhou, China) as controls. The median age was 6 years (range, 0.1–16 years) and the median WBC was 7.84×10⁹/l (2.92–18.63×10⁹/l). Treatments for AL included chemotherapy and extramedullary leukemia prevention. Patients with ALL were given chemotherapy according to the Children's Cancer & Leukaemia Group-2008 regimen (27) and AML patients were treated using state-of-the-art generic chemotherapy. The present study was approved by the Ethics Committee of the Children's Hospital of Soochow University (Suzhou, China) and signed informed consent was provided by the patient's parents or guardians. The prednisone sensitivity test was performed according to the Children's Cancer & Leukemia Group 2008 regimen (27).

K562 or HL-60 cells were seeded into a six-well plate (1.0–1.5×10⁶ cells per well; four well per cell line). 2 µl 5-aza-2-dC (FINC Chemical Technology, Shanghai, China) was added into two wells of each cell type. Following incubation for 48 h, 1 ml TRIzol (Thermo Fisher Scientific) was added to each well. DNA and RNA were extracted from each group for RT-qPCR and MSP experiments.

Total RNA was extracted from monocytes with TRIzol according to the manufacturer's instructions. 2 µg RNA was used to generate the cDNA library for amplifying target genes. A TaqMan MicroRNA Reverse Transcription kit (Thermo Fisher Scientific) was used to synthesize the cDNA. The reaction mixture contained 0.15 µl 100 mM deoxynucleotide triphosphate, 1 µl MultiScribe reverse transcriptase, 1.5 µl reverse transcription buffer (10X), 0.19 µl RNase inhibitor, 4.16 µl nuclease-free water, 3 µl primer and 5 µl RNA. The following conditions were used for reverse transcription: 16°C for 30 min, 42°C for 30 min, 80°C for 5 min and 4°C for 1 min.

The TaqMan MicroRNA Assay and TaqMan Universal PCR Master Mix (Thermo Fisher Scientific) were used to amplify the cDNA in a LightCycler 480^® II (Roche, Basel, Switzerland). The reaction contained 1 µl TaqMan MicroRNA Assay mixture (20X), 1.3 µl cDNA product mixture, 10 µl TaqMan Universal PCR Master Mix (2X) and 7.7 µl nuclease-free water. FAM™ dye (GenePharma, Shanghai, China) was added as the fluorescence probe. PCR was performed using the following cycling conditions with incorporation of FAM into the nucleotides: 95°C for 10 min, followed by 55 cycles of 95°C for 15 sec and 60°C for 60 sec. U6 small nuclear (sn)RNA (5′-GTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACGATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTCCATATTTT-3′) was used as an internal control to normalize the relative repression levels of miR-34b mimics (5′-UAGGCAGUGUCAUUAGCUGAUUG-3′). Melting curve analysis was performed and the R-value was calculated from the difference between the target gene in the experimental group compared to that of the control group, using the 2^−ΔΔCt method where Ct was the cycle threshold (i.e., the cycle number at which the fluorescence reached the set threshold). ΔCt was calculated by subtracting the Ct value of the U6 snRNA reference from the Ct value of miR-34b mimics: ΔCt_miR-34b = Ct_miR-34b − Ct_{U6 snRNA}. ΔΔCt was then calculated by subtracting the ΔCt of the respective sample from the ΔCt of the control group: ΔΔCt = ΔCt_Sample − ΔCt_Control. Triplicate experiments were performed for each sample.

The primers used for PCR amplification were as follows: miR-34b forward, 5′-TGGTTTAGTTATGTGTGTTGTGT-3′ and reverse, 5′-CAACTACAACTCCCAAACAATCC-3′ (Invitrogen; Thermo Fisher Scientific).

The TIANamp Genomic DNA kit (Tiangen, Beijing, China) was used to extract the genomic DNA from cell lines and monocytes according to the manufacturer's instructions. Briefly, cells were centrifuged at 400 × g for 5 min. 200 µl GA buffer was added after removing the supernatant. After proteinase K treatment, 200 µl GB buffer was added followed by incubation at 70°C for 10 min. 200 µl ethanol was then added and DNA was purified using the column included in the kit. The DNA concentration was measured with a BioMate™ 35 ultraviolet spectrophotometer (Chemlab Corp., Shanghai, China). The EZ Methylation-Gold kit (Zymo Research, Irvine, CA, USA) was used to modify the genomic DNA with sodium bisulfite according to the manufacturer's instructions. Conversion Reagent was prepared by adding 900 µl water, 50 µl M-Dissolving Buffer and 300 µl M-Dilution Buffer into a tube of CT Conversion Reagent supplied with the kit. 130 µl CT Conversion Reagent was mixed with 20 µl genomic DNA and reacted for 10 min at 98°C, followed by 2.5 h at 64°C. 600 µl M-Binding Buffer was mixed with DNA sample in a Zymo-Spin IC Column (Zymo Research). After centrifugation at 400 × g for 10 sec, 200 µl M-Desulphonation Buffer was added onto the same column following incubation for 15–20 min at room temperature. The column was then washed twice with M-Wash buffer. 10–20 µl M-Elution Buffer was used to elute the modified genomic DNA. Takara Taq™ (Takara Bio, Inc., Otsu, Japan) was used for methylation-specific PCR. The sequences of the primers were as follows (12): Methylated miR-34b forward, 5′-TTTAGTTACGCGTGTTGTGC-3′ and reverse, 5′-ACTACAACTCCCGAACGATC-3′; unmethylated miR-34b forward, 5′-TGGTTTAGTTATGTGTGTTGTGT-3′ and reverse, 5′-CAACTACAACTCCCAAACAATCC-3′.

Transfection was performed using Lipofectamine 2000 (Thermo Fisher Scientific) according to the manufacturer's instructions. In brief, 4×10⁵ K562 cells were cultured in 2 ml antibiotic-free RPMI 1640 medium containing 10% FBS in a six-well plate one day prior to transfection. 24 µl Homo sapiens (hsa)-miR34b mimics and 24 µl negative control (GenePharma) were mixed with 226 µl Opti-MEM (Invitrogen), respectively. 12 µl Lipofectamine 2000 was mixed with 238 µl Opti-MEM and then mixed with the hsa-miR-34b mimics- or negative control-Opti-MEM solution. After incubation for 20 min at room temperature, the mixtures were added drop-wise to the cultured cells. Culture medium was replaced 4–6 h after transfection. Each transfection was performed in three replicates. The sequences of the FAM-labeled miRNAs were as follows: hsa-miR-34b mimics sense, 5′-CAAUCACUAACUCCACUGCCAU-3′ and anti-sense, 5′-GGCAGUGGAGUUAGUGAUUGUU-3′; negative control sense, 5′-UUCUCCGAACGUGUCACGUTT-3′ and anti-sense, 5′-ACGUGACACGUUCGGAGAATT-3′.

Cells were harvested 48 h after transfection. Following two washes with phosphate-buffered saline, cells were re-suspended in 600 µl phosphate-buffered saline and analyzed on a FACScan flow cytometer (BD Biosciences, San Jose, CA, USA). Data were analyzed using CellQuest Pro 5.2 software (BD Biosciences).

After transfection, cells in the exponential phase were collected in RPMI 1640 medium containing 10% FBS. Cell suspension (200 µl) was added into each well of five 96-well plates at a concentration of 2.5×10⁴/ml. Cells were analyzed at the time-points of 24, 48, 72, 96 and 120 h. Five replicates of the blank control, negative control, experimental group and culture medium control were assessed at each time-point. 20 µl CCK-8 (Shanghai Yes Service Biotech, Shanghai, China) was added into each well and cells were incubated for another 2 h. The optical density at 450 nm (OD₄₅₀) was then assessed using a microplate reader (MultiSkan FC, Thermo Fisher Scientific) and regarded as a measure of the number of viable cells.

All statistical analyses were performed using SPSS version 17.0 software (SPSS, Inc., Chicago, IL, USA). Values are expressed as the mean ± standard deviation. Student's t-test was used for comparisons among multiple groups. P<0.05 was considered to indicate a statistically significant difference.

First, RT-qPCR analysis was performed to compare the expression levels of miR-34b between 8 leukemia cell lines as well as the BMNCs of 42 ALL patients, 20 AML patients, 11 patients with MLL and 20 age-matched normal individuals. Compared with that in normal controls (5.22±1.15), the relative expression of miR-34b in leukemia cell lines (0.03±0.03; P<0.01) as well as in BMNCs cells of patients with ALL (1.65±0.69; P<0.05), AML (0.18±0.06; P<0.01) and MLL (0.64±0.34; P<0.01) was significantly downregulated (Table I, Fig. 1). This result indicated that miR-34b may represent a diagnostic indicator for leukemia. To further evaluate the potential of using miR-34b as a clinical marker for AL, miR-34 expression in AL patients was compared with their clinical parameters. However, no correlation between the expression levels of miR-34 and the patients' gender, age, WBC number, immunophenotype, karyotype, gene fusion, MLL gene rearrangement or LDH levels were identified (P>0.05) (Table II). Of note, the expression levels of miR-34b in patients sensitive to the ALL prednisone reaction (0.67±0.22) were significantly lower than those in insensitive patients (4.40±2.45; P=0.015) (Table II).

To assess the effects of miR-34b on cell proliferation, hsa-miR-34b mimics and negative control RNA were transfected into K562 cells. The transfection efficiency of hsa-miR-34b in K562 cells was 61%, as determined by flow cytometry (Fig. 2A). K562-cell proliferation was then evaluated using the CCK-8 cell proliferation assay. The OD₄₅₀-values of hsa-miR-34b-transfected cells were significantly lower than those of non-transfected cells or negative control-transfected cells at 48 h, 72 h, 96 h and 120 h (P<0.01) (Fig. 2B). At 72 h, cell proliferation was inhibited by 45.7% in hsa-miR-34b mimic-transfected cells as compared with that in negative control cells (Fig. 2B).

To examine whether the methylation of CpG island in the promoter of miR-34b is involved in the regulation of its expression, MSP analysis was performed to detect the methylation status of CpG islands in leukemia cell lines as well as in BMNCs from ALL patients, AML patients MLL patients and healthy controls. No methylation was detected in cells from all 23 normal control subjects (results from 13 controls are shown in Fig. 3A). However, methylation was present in the miR-34b gene promoters of all leukemia cell lines (U937, HL-60, MV4-11, M2R, K562, Raji, CCRF and DAMI) (Fig. 3B). Among the 31 ALL patients, methylation was detected in 24 patients (results from 15 patients are shown in Fig. 3C). Among the 19 AML patients, methylation was detected in eight patients (results from nine patients are shown in Fig. 3D). The methylation status was then assessed in all acute leukemia patients. Similarly, no correlation was found between methylation and patients' gender, age, karyotype, gene fusion, MLL gene rearrangement, TEL/AML1 gene, Hb number, WBC count, platelet count or LDH levels (P>0.05) (Table III). However, a significant difference in miR-34b promoter methylation was detected between patients with ALL and those with AML (P=0.012) (Table III). Thus, the methylation status of the miR-34b promoter may be utilized as a marker for the diagnosis of leukemia sub-types.

To evaluate the association between the expression levels and the CpG island methylation status of the miR-34b gene promoter, HL-60 and K562 cells were treated with the demethylating agent 5-aza-2-dC. Methylation of the promoter of miR-34b was obviously decreased by 5-aza-2-dC (Fig. 4A). Furthermore, miR-34b expression in 5-aza-2-dC-treated HL-60 and K562 cells was 49.5- and 18.8-fold increased, respectively, compared with that in untreated cells (Fig. 4B).