The A549 lung cancer cells were obtained from the American Type Culture Collection (Manassas, VA, USA) and cultured in RPMI-1640 media (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific, Inc.) and antibiotics (Gibco Antibiotic-Antimycotic containing mphotericin B, penicillin and streptomycin; Gibco, Thermo Fisher Scientific, Inc.) at 37°C in a humidified incubator containing 5% CO₂. The cells, at a density of 5×10⁵, were exposed to various doses of irradiation (0, 0.5, 1, 2, 4, 5, 6, 8 and 10 Gy) using a Cs-137 irradiator (HWM D-2000; Siemens, Waltershausen, Germany) at a dose rate of 2 Gy/min. Irradiation was administered at room temperature and the cells were subsequently incubated at 37°C, and harvested for the following experiments.

The following antibodies were used in the present study: Anti-hexokinase 2 (HKII) (cat. no. 2867), anti-pyruvate kinase (PK)M2 (cat. no. 4053), anti-lactate dehydrogenase (LDH)A (cat. no. 2012), anti-β-actin (cat. no. 4967) (Cell Signaling Technology, Inc., Danvers, MA, USA), and anti-hypoxia-inducible factor (HIF)1α (cat. no. sc-10790; Santa Cruz Biotechnology, Inc., Dallas, TX, USA).

HIF-1α siRNA sequences (cat. no. 106498) and negative control siRNA were purchased from Ambion (Thermo Fisher Scientific, Inc.). Cells were seeded onto 6-well plates at a density of 1×10⁵ cells/well. A plasmid vector containing wild type HIF1α was purchased from Addgene (Cambridge, MA, USA). Transfection was performed using Lipofectamine^® 2000 and Opti-MEM I reduced serum medium (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Transfection temperature was 37°C, and the volume of siRNA/vector and Lipofectamine used was 100 nM siRNA/vector and 5 µl Lipofectamine, respectively for each transfection. A total of 48 hours post-transfection, the cells were prepared for further analysis.

The precursor and antisense sequences of miR-21 were chemically synthesized by GenePharma Co., Ltd. (Shanghai, China). The cells were seeded in 6-well plates at 1×10⁵ cells/well and cultured overnight. Subsequently, the cells were transfected with 200 nM pre-miR-21, inhibitors or negative control, using Lipofectamine^® 2000 and Opti-MEM I reduced serum medium (Invitrogen), according to the manufacturer's protocol. A total of 48 hours post transfection, the cells were prepared for further analysis.

The cells were seeded into 96-well culture plates at a density of 5×10³. Following cellular adhesion, the cells were exposed to various doses of irradiation. Following irradiation, 20 µl 5 mg/ml 3-(4,5-dimethylthiazol-2-yl)-2,5-di-phenyltetrazolium bromide (MTT; Sigma-Aldrich, St. Louis, MO, USA) was added to each well. Following a 4 h incubation at 37°C, the medium was gently aspirated and replaced with 150 µl dimethylsulfoxide. The absorbance of each well was detected at a wavelength of 570 nm using an ELx800 Absorbance Reader (BioTek Instruments, Inc., Winooski, VT, USA). The experiment was conducted in triplicate.

Total RNA was extracted from the cells using the Absolutely RNA RT-PCR Miniprep kit (Agilent Technologies, Inc., Santa Clara, CA, USA), according to the manufacturer's protocol. Total RNA concentration was adjusted to 2 ng/µl using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Inc.). Total RNA (1 µg) was reverse transcribed using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.). The cDNA was then diluted to 1:10 for use as a template for RT-qPCR. PCR amplifications were performed in a final reaction volume of 10 µl containing: 5.5 µl TaqMan Universal PCR Master mix (Applied Biosystems), 0.5 µl primers and probes mix and 4.5 µg cDNA. The cycling conditions were as follows: One cycle at 50°C for 2 min, one cycle at 95°C for 10 min, followed by 40 cycles of denaturation (95°C for 15 sec), and a final annealing/extension step at 60°C for 1 min. All reactions were conducted using the Step One Plus Real-Time PCR Systems Thermocycler (Applied Biosystems). All quantitative PCR reactions were carried out in triplicate and repeated at least twice. The ΔC_{quantification} (ΔCq) for mRNA expression was calculated relative to the C_q of 18S ribosomal RNA. Relative mRNA expression was calculated using the formula 2^(−ΔΔCq). The primers used for qPCR were as follows: LDHA, forward ATCTTGACCTACGTGGCTTGGA and reverse CCATACAGGCACACTGGAATCTC; HKII, forward CAAAGTGACAGTGGGTGTGG and reverse GCCAGGTCCTTCACTGTCTC; and PKM2, forward GAGGCCTCCTTCAAGTGCT and reverse CCAGACTTGGTGAGGACGAT. RT-qPCR quantification using the TaqMan-miRNA assay (Applied Biosystems) was conducted to determine the expression levels of miR-21 (cat. no. 4427975; assay ID 000397), using the cycling conditions previously described. qPCR was performed using the Step One Plus Detection system (Applied Biosystems), according to the manufacturer's protocol. The relative expression values of the specific miRNA were calculated using the 2^−ΔΔCq method, normalized to the control miRNA (GAPDH: 5′-AATCCCATCACCATCTTCCA-3′ forward and 5′-TGGACTCCACGACGTACTCA-3′ reverse). All reactions were performed at least twice in duplicate.

The cells were seeded in 6-well plates at a density of 5×10⁵ cells/well in 3 ml culture medium. Then, conditioned medium and distilled water were mixed at a 1:20 ratio (conditioned medium:distilled water. The glucose concentration in the diluted medium was measured using the Glucose Assay kit (Sigma-Aldrich), according to the manufacturer's protocol. Glucose consumption was calculated by subtracting the concentration of glucose remaining in the medium 24 h later from the concentration of glucose present in the fresh cell culture medium. Lactate concentrations were determined using a Lactate Assay kit (BioVision, Mountain View, CA, USA) according to the manufacturer's protocol. Samples and a lactate standard were prepared with lactate assay buffer in a 96-well plate. Subsequently, 50 µl lactate enzyme mix was added to each well, and incubated for 30 min at room temperature. Optical density values were measured at 570 nm using a microplate reader (SpectraMax M2e; Molecular Devices, LLC, Sunnyvale, CA, USA). The results were normalized to the amount of total protein, as compared with the control cells.

The cells were harvested and washed with ice-cold phosphate-buffered saline (PBS). Cell lysates were obtained by re-suspending the cells in radioimmunoprecipitation assay buffer [10 mM Tris (pH 7.4), 150 mM NaCl, 1% Triton X-100, 1% Na-deoxycholate (Kanto Chemical Co., Inc., Tokyo, Japan)] and 5 mM EDTA supplemented with protease inhibitor cocktail (Sigma-Aldrich). The protein concentration of the cell lysates was determined by Bradford assay, using a Bradford kit (Beyotime Institute of Biotechnology, Shanghai, China). Equal quantities of protein (1 µg/µl) were separated by 10% homemade sodium dodecyl sulfate-poly-acrylamide gel electrophoresis and electrotransferred onto a polyvinylidene difluoride membrane (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The membranes were blocked with 5% non-fat milk and incubated overnight with primary antibodies at 4°C at a dilution of 1:1,000. The membranes were then washed with PBS with Tween 20 and incubated at room temperature for 1 h with horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G secondary antibodies (cat. no., 7074; dilution, 1:3,000; Nichirei Biosciences, Inc., Tokyo, Japan). Protein bands were visualized using Chemi-Lumi One L Western Blotting Substrate (Nacalai Tesque, Kyoto, Japan).

Statistical analysis was performed using Prism 5.0 (GraphPad Software, Inc., La Jolla, CA, USA) and the unpaired Student's t-test was used to analyze the data. All data are presented as the mean ± standard error. P<0.05 was considered to indicate a statistically significant difference.

To investigate the association between miR-21 expression and radiation sensitivity, a radiation-resistant non-small cell lung cancer cell line was generated using A549 parental cells, according to a previous study (22). The cells were treated with increasing doses of radiation for 4 months, in order to generate resistant cells. Resistant cell clones were developed and pooled. To confirm that the cells were radioresistant, the A549 parental cells and resistant cells underwent various doses of irradiation. A total of 72 h post-irradiation cellular proliferation was determined using an MTT assay (Fig. 1A). The A549 radiation-resistant cells were able to tolerate higher intensities of radiation. In addition, the expression levels of miR-21 were significantly upregulated in the radiation-resistant cells, as compared with the sensitive cells (Fig. 1B), thus suggesting that miR-21 may contribute to radioresistance in non-small lung cancer. To confirm the above observation, A549 cells were transiently transfected with pre-miR-21, in order to overexpress miR-21. The radiation sensitivity of A549 cells with and without overexpression of miR-21 were subsequently measured following treatment with the indicated doses. The A549 cells had an increased survival capacity in response to irradiation following transfection with miR-21 (Fig. 1C). These data indicate a strong correlation between miR-21 and radioresistance in lung cancer cells, suggesting that miR-21 may be a target for overcoming radiation resistance.

Enhanced anaerobic glycolysis often accompanies radioresistance in cancer. To determine the mechanisms underlying miR-21-promoted radioresistance, the glycolysis rates of radiation-sensitive and -resistant A549 cells were detected. The glucose consumption and lactate production were determined. As shown in Fig. 2A, glucose consumption and lactate production were promoted in the radiation-resistant cells, thus indicating that upregulated anaerobic glycolysis may be associated with the radioresistance. In addition, the expression levels of glycolysis-associated enzymes were detected. The protein and mRNA expression levels of HKII, PKM2 and LDHA were upregulated in the radioresistant cells (Fig. 2B and C). These results suggest that enhancement of glycolysis by miR-21 is mediated via upregulation of glycolysis-associated enzymes at the transcriptional level.

To further explore the mechanisms underlying the miR-21-mediated transcriptional regulation of the key enzymes of glycolysis in radiation-resistant cells, a literature search was conducted, focusing on HIF1α, which is a heterodimeric transcription factor induced by hypoxia, growth factors and oncogenes. It has previously been reported that under hypoxic conditions HIF1α may be activated and stimulate the transcription of downstream target genes, including LDHA and HKII (23). In the present study, it was hypothesized that HIF1α may be activated in radioresistant cells, and have an important role in radioresistance by promoting the expression of downstream glycolytic enzymes. To determine whether miR-21 affects HIF1α expression, the A549 radiation-sensitive and -resistant cells were transfected with an miR-21 precursor or control miRNA, and the expression levels of HIF1α and glycolytic key enzymes were detected, and glucose consumption and lactate production were measured. As hypothesized, overexpression of miR-21 significantly increased the expression levels of HIFα and the key enzymes of glycolysis (Fig. 3A). Consistently, glucose consumption and lactate production were increased following miR-21 transfection (Fig. 3B). To confirm that miR-21 promotes the glycolysis of non-small cell lung cancer cells through the upregulation of HIF1α, HIF1α expression was silenced in the miR-21-pretransfected cells using siRNA (Fig. 3C). Glucose consumption and lactate production were downregulated following inhibition of HIF1α (Fig. 3D). These results indicate that miR-21-regulated HIF1α may be associated with the underlying mechanism of radioresistance.

To determine whether miR-21 inhibition was able to enhance the radiosensitivity of lung cancer cells, A549 cells were transfected with anti-sense oligonucleotides targeting miR-21 or a scrambled miRNA control (Fig. 4A). Glycolysis was measured 48 h post-transfection. Inhibition of miR-21 decreased glycolysis, as detected by measuring glucose consumption and lactate production (Fig. 4B and C). In addition, A549 cells transfected with anti-miR-21 or control miRNA were exposed to various doses of radiation (0, 0.5, 1, 2, 4 and 6 Gy) at a rate of 2 Gy/min, and a cell survival assay was performed. The survival fraction of the anti-miRNA-21-transfected cells was significantly decreased, as compared with the control group (Fig. 4D). These results indicate a correlation between miR-21 expression and the radiosensitivity of A549 cells to γ-radiation.

To further investigate whether miR-21 is capable of modulating the sensitivity of radioresistant lung cancer cells, the A549 radioresistant cells were transfected with anti-miR-21 or a negative control (Fig. 5A). Inhibition of miR-21 significantly increased the susceptibility of the radioresistant cells to irradiation, as compared with the negative control-transfected cells. The half maximal inhibitory concentration (IC₅₀) of the anti-miR-21-transfected A549 cells was 2 Gy, which was lower than the IC₅₀ of the negative control-transfected A549 cells, which was 15 Gy (Fig. 5B). To determine the correlation between HIF-1α and anti-miR-21-induced sensitivity, the anti-miR-21-transfected A549 radioresistant cells were transiently transfected with an overexpression vector containing wild type HIF-1α, in order to rescue its function. With the restoration of HIF1α, the expression levels of the key enzymes of glycolysis were rescued (Fig. 5C). In addition, the sensitivity of HIF1α-transfected radioresistant cells to various doses of radiation was determined. As shown in Fig. 5D HIF1α-transfected A549 radioresistant cells regained resistance to radiation. These results suggest that inhibition of miR-21 modulates the sensitivity of A549 radioresistant cells to irradiation via the downregulation of HIF1α.