Neonatal rat cardiomyocytes were isolated from 1-day-old Sprague Dawley rats (Sibeifu Co., Beijing, China), the heart tissue was digested with trypsin and type II collagenase. The cells were seeded in high glucose Dulbecco's modified Eagle's medium (DMEM; Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) with 10% FBS (Hyclone; GE Healthcare Life Sciences) at the density of 5×10⁴ cells/cm². The present study was approved by the ethics committee of Henan Provincial People's Hospital (Zhengzhou, China).

HEK293T cells were purchased from American Type Culture Collection (Manassas, VA, USA) and were cultured in DMEM/F12 (Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) supplemented with 10% fetal bovine serum, 100 U/ml penicillin and streptomycin (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) in a 25 cm² culture flask at 37°C in a humidified atmosphere of 5% CO₂.

Cells were cultured on six-well chamber slides and washed with phosphate-buffered saline (PBS) three times for 5 min). The slides were incubated with ROS Fluorescent Probe-DHE (Vigorous Biotechnology Beijing Co., Ltd, Beijing, China) in serum-free DMEM/F-12 medium for 30 min at 37°C in a dark environment. The slides were fixed in 4% paraformaldehyde for 20 min at room temperature, washed with PBS for three times and mounted. Immunofluorescence images were captured using a fluorescence microscope.

Cell viability was determined using a colormetric MTT assay (Sigma-Aldrich, St. Louis, MO, USA). To investigate the effects of DOX on cardiomyocyte viability, cells were cultured at ~70% confluency and cultured in serum-free DMEM overnight. Subsequently, 1, 10, 100 nM, 1, and 10 µM DOX was incubated with the primary cardiomyocytes for 24 h at 37°C. MTT (0.5 mg/ml) was added in fresh medium for 4 h and dimethyl sulfoxide was added into the wells. The absorbance was detected spectrophotometrically at a wavelength of 550 nm. To determine the time-dependent effects of DOX, cells were treated with 1 µM DOX for 8, 16, 24 and 48 h prior to investigation of cell viability according to the above methods. Each experiment was independently performed at least 3 times.

Proteins were isolated from cardiomyocytes in radioimmunoprecipitation assay buffer [1% Triton X-100, 150 mmol/l NaCl, 5 mmol/l EDTA and 10 mmol/l Tris-HCl (pH 7.0)] obtained from Beijing Solarbio Science & Technology Co., Ltd. (Beijing, China) with supplementation of protease inhibitor cocktail (Sigma-Aldrich). Protein was quantified using a Pierce BCA Protein assay kit (Thermo Fisher Scientific, Inc.). Cell lysates (10 µg protein) were separated by 10% SDS-PAGE and transferred to a polyvinyl difluoride membrane. The membrane was blocked with 8% milk for 2 h at room temperature. The membrane was incubated at 4°C overnight with primary antibodies as follows (all from Cell Signaling Technology, Inc., Danvers, MA, USA unless otherwise stated): p72 (1:1,000; Abcam, Cambridge, MA, USA; cat. no. ab24601), rabbit anti-ERα (1:1,000; cat. no. 8644), rabbit anti-p-Akt (1:1,000; cat. no. 4060), rabbit anti-Akt (1:1,000; cat. no. 4691), rabbit anti-p-caspase 3 (1:1000; cat. no. 9664), rabbit anti-caspase 3 (1:1000; cat. no. 9665) and mouse anti-β-actin (1:4,000; cat. no. 3700). Following incubation overnight and washing three times for 5 min with PBS with Tween 20, the horseradish peroxidase-conjugated goat anti-rabbit IgG secondary antibodies (1:5,000; Origene Technologies, Beijing, China; cat. no. ZB-2301) were used at room temperature for 2 h. Immunodetection was achieved using the Chemilucent Plus ECL Detection kit (EMD Millipore, Billerica, MA, USA) according to the manufacturer's protocols. Images of the blots were captured using an imager. β-actin served as the internal control and Image J 5.0 (imagej.nih.gov) was used to quantify the results.

The TUNEL assay was performed using the In Situ Cell Death Detection kit (Roche Diagnostics, Basel, Switzerland). Following staining, the cells were washed with cold PBS and examined under a fluorescence microscope.

Phusion High-Fidelity enzyme (Thermo Fisher Scientific, Inc.) was used for cloning purposes. The entire p72 cDNA was amplified by RT-PCR using specific primers for p72-BamHI-forward (GCGGATCCCCGCGGCACTGCCCGGTTTG) and p72-EcoRI-reverse (GCGAATTCTACAAGTCTTTCAAGTCTTA) and then cloned into the expression vector, pCDH-CMV-MSC-EF1-copGFP (System Biosciences, Palo Alto, CA, USA) with a Cold Fusion Cloning kit (System Biosciences). Recombinant adenovirus was generated from 293T cells with calcium phosphate precipitation. Primary cardiomyocytes were seeded at 1×10⁶ cells/well in the 6-well plates. Then, the adenovirus vectors were transfected into cardiomyocytes for 48 h.

Data were presented as the mean ± standard error of the mean from three independent experiments. Statistical analysis was conducted using Student's t-test on GraphPad Prism 6 (GraphPad, Inc., La Jolla, CA, USA). P<0.05 was considered to indicate a statistically significant difference.

Primary cardiomyocytes were treated with 1 µM DOX for 24 h. As presented in Fig. 1A, ROS production was enhanced in primary cardiomyocytes as demonstrated using DHE staining. Furthermore, the present study investigated the protein expression levels of p-caspase-3, c-caspase-3, p-Akt and Akt. Caspase-3 activation was enhanced with DOX treatment, while the phosphorylation level of Akt was reduced (P<0.05; Fig. 1B). These data indicated that DOX induced cardiomyocyte injury by increasing ROS production and apoptosis.

Following 1 µM DOX treatment for 8, 16, 24 and 48 h, cell viability was decreased by 22 and 35% at 24 and 48 h, respectively (each P<0.05; Fig. 2A). Preincubation with 10, 100 nM, 1 and 10 µM DOX for 24 h decreased cell viability by 26 and 54% at 1 and 10 µM DOX, respectively (P<0.05 and P<0.01, respectively; Fig. 2B). These results suggested that DOX reduced cardiomyocyte viability in a time- and dose-dependent manner. Furthermore, protein expression levels of p72 were also detected under the same conditions. As presented in Fig. 2C and D, p72 expression levels were decreased following DOX treatment at the concentration of 1 µM for 24 h. Thus, 1 µM DOX was used for 24 h in the remaining experiments.

To investigate the effect of p72 on cardiomyocyte apoptosis, adenovirus vectors expressing p72 were introduced into primary cardiomyocytes. As presented in Fig. 3A, overexpression of p72 reduced DOX-induced ROS production in cardiomyocytes. Following induction of p72 overexpression, cell viability was significantly enhanced in the DOX-induced group (P<0.05; Fig. 3B). TUNEL staining was also conducted to detect apoptotic cells. Notably, p72 overexpression significantly reduced DOX-induced cell apoptosis (Fig. 3C). These data indicated that p72 exerts a protective effect in DOX-induced cardiomyocyte injury.

To investigate the underlying mechanism by which p72 regulates cardiomyocyte viability, the downstream signaling pathway was assessed. As presented in Fig. 4, overexpression of p72 significantly enhanced ERα activation and increased the phosphorylation level of Akt (each P<0.01). By contrast, DOX significantly reduced ERα activation (P<0.05) and increased the phosphorylation level of Akt (P<0.05). These data indicated that p72 overexpression protected against cardiomyocyte injury predominantly by enhancing ERα activation and Akt phosphorylation.