Ximenynic acid is a conjugated enyne fatty acid, which is currently of interest due to its anti-inflammatory activity. Due to the association between inflammation and cancer, the present study was designed to investigate the anti-cancer activity of ximenynic acid in the HepG2 human hepatoma cell line and the underlying mechanisms. The current study demonstrated the anti-proliferation and pro-apoptosis activities of ximenynic acid by cell viability assay and flow cytometry analysis. The expression of anti-apoptosis protein silent information regulator T1 (SIRT1) was significantly suppressed by ximenynic acid. Furthermore, ximenynic acid blocked G1/S phase transition by inhibiting the protein expression of the cell cycle-associated protein general control of amino acid synthesis yeast homolog like 2 (GCN5L2), and the mRNA expression of cyclin D3 and cyclin E1. Furthermore, ximenynic acid suppressed the expression of angiogenesis-associated genes, including vascular endothelial growth factor (VEGF)-B and VEGF-C. Finally, ximenynic acid significantly inhibited the expression of cyclooxygenase-1 (COX-1) mRNA and protein, however COX-2 expression was not reduced. The results of the present study suggested that ximenynic acid may inhibit growth of HepG2 cells by selective inhibition of COX-1 expression, which leads to cell cycle arrest, and alters the apoptosis pathway and expression of angiogenic factors. The current study aimed to investigate whether ximenynic acid might be developed as novel anticancer agent.
Ximenynic acid (also termed santalbic acid) is a conjugated enyne fatty acid that predominantly exists in the seed oil of the Santalaceae, Olacaceae, and Opiliaceae families (
The anti-inflammatory activity of ximenynic acid has been reported since the 1980s. Nugteren and Christ-Hazelhof (
Arachidonic acid metabolism pathways, induced by lipoxygenase, cyclooxygenase (COX) and cytochrome P450, are important for regulating the inflammatory response (
There are two common types of COX: COX-1 and COX-2. Although COX-2 inhibitors for treating cancer have been a research focus for many years, suppression of COX-1 was also demonstrated to exhibit anti-cancer properties (
There are few reports that directly demonstrate the anti-cancer activity of ximenynic acid, thus, it was hypothesized that ximenynic acid may have antitumor properties through inhibition of COX activation. The current study investigated the anti-cancer activity of ximenynic acid in HepG2, and analyzed the underlying mechanism through determining its effects on cell cycle, angiogenesis and COXs pathways.
Ximenynic acid was obtained (99.5% purity) from the seed oil of
HepG2 human hepatoma cell line was obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Cells were grown in high glucose Dulbecco's modified Eagle's medium (DMEM; Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) supplemented with 110 mg/l sodium pyruvate, 4 mM L-glutamine, 10% fetal bovine serum (Biowest, Nuaillé, France), 10 mM HEPES (Corning Incorporated, Corning, NY, USA), 100 U/ml penicillin and 0.1 mg/ml streptomycin at 37°C in a humidified incubator with 5% CO2. The medium was changed every 2 days. Cells were passaged when they reached 70–80% confluence, and the culture medium was changed 1 day before.
Cells were seeded overnight in standard medium and then change to serum-free medium supplemented with 1% insulin-transferrin-selenium (ITS; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), 0.1 mg/ml fatty acid-free bovine serum albumin (BSA; MP Biomedicals, LLC, Santa Ana, CA, USA) for synchronizing cell cycle division. After 24 h serum starvation, cells were incubated in experimental media for indicated times. The experimental media was DMEM supplemented with 1% ITS, 0.1 mg/ml BSA and various concentrations of ximenynic acid or oleic acid with a molar ratio of 4:1 to BSA. Cells treated with medium not containing fatty acids were termed the vehicle control group.
Cells were cultured in 96-well plates overnight with ~1500 cells/well. After serum-starving for 24 h, serum-free medium was removed and ximenynic acid or oleic acid at 25, 50, 100 and 150 µM were added to the cells. After 72 h incubation, the media were replaced with serum-free medium diluted methyl thiazolyl tetrazolium (MTT; Amresco, LLC, Solon, OH, USA) solution (5 mg/ml) and incubated at 37°C for 4 h. Subsequently, MTT medium was removed and the cells were dissolved with dimethyl sulfoxide followed by detection of absorption at 595 nm with the Bio-Rad iMark Microplate Absorbance Reader (Bio-Rad Laboratories, Inc., Hercules, CA, USA).
Cell cycle distribution was analyzed by propidium iodide (PI) staining. Cells were seeded in the 6-well plates overnight, and then incubated with serum-free media containing 50 or 150 µM ximenynic acid or oleic acid for 24 h and 36 h following rinsing with phosphate-buffered saline (PBS). The harvested cells were slowly fixed in pre-chilled 70% ethanol following washing with PBS. The fixed cells were incubated at −20°C overnight. Subsequently to rinsing with PBS, cells were re-suspended with PI solution from the Cell Cycle Staining kit [CCS012; Multi Sciences (Lianke) Biotech Co., Ltd., Hangzhou, China] and incubated in a dark at room temperature for 30 min. Cell cycle distribution was then analyzed using BD FACSCalibur (Becton Dickinson, USA).
Cell apoptosis was analyzed with Annexin V-FITC (fluorescein isothiocyanate) and PI kit (Multisciences, China). Cells were cultured in 6-well plates overnight, and then starved for 24 h with serum-free medium followed by culture with different concentrations of ximenynic acid or oleic acid for 72 h. The harvested cells were gently rinsed with PBS. Cells were stained with Annexin V-FITC and PI in dark for 15 min. The level of apoptosis was then analyzed by BD FACSCalibur (BD Biosciences, Franklin Lakes, NJ, USA).
Cells were seeded in 6-well plates overnight. After starving for 24 h with serum-free medium, cells were treated with 50 or 150 µM ximenynic acid or oleic acid for 72 h. Total RNA was extracted by HP Total RNA kit (Omega Bio-Tek, Inc., Norcross, GA, USA) according to the manufacturer's protocol, and the RNA concentration was determined using a NanoDrop 2000 (Thermo Fisher Scientific, Inc., Wilmington, DE, USA). RT was performed on total RNA to produce cDNA with using a Transcriptor First Strand cDNA Synthesis kit (Roche Diagnostics, Basel, Switzerland). The expression of genes was analyzed by qPCR. The sequences of primers are presented in
Cells were cultured in 100 mm dishes overnight and then starved with serum-free medium for 24 h. After treatment with 50 or 150 µM ximenynic acid or oleic acid for 72 h, cells were harvested and proteins were extracted using cell lysis buffer supplemented with phenylmethylsulfonyl fluoride (Beyotime Institute of Biotechnology, Haimen, China). Whole-cell lysates were centrifuged at 20,000 ×
Data are expressed as the mean ± standard deviation of three independent experiments. The significance of the difference between groups was analyzed by SPSS software version 18 (SPSS, Inc., Chicago, IL, USA) using the Bonferroni or Dunnett's T3 method of single factor analysis of variance (
HepG2 cells were treated with different concentrations (0–150 µM) of ximenynic acid or oleic acid for 72 h, and the cell viability was measured by MTT assay. As shown in
Considering the anti-proliferation activity of ximenynic acid demonstrated in
The degradation of pro-caspase-3 protein occurs during the process of cell apoptosis, which results in protein cleavage into several fragments (
The upstream signals that mediate the effect of ximenynic acid on apoptosis remain unclear. SIRT1 is a NAD-dependent deacetylase that inhibits apoptosis by downregulating transcriptional activity of p53 (
Cell cycle arrest in G1/S transition can induce cancer cell apoptosis (
To understand whether ximenynic acid affects the expression of cell cycle-associated genes in HepG2 cells, qPCR analysis was performed to determine the expression variation of cyclin genes, including cyclin E1 (
GCN5L2 (also termed lysine acetyltransferase 2A) is a typical histone acetyltransferase (HAT), which promotes cell cycle progression by acetylation and deacetylation of histones (
COX-1 and COX-2 mRNA and protein were demonstrated to be expressed in the HepG2 cells (
Unexpectedly, compared with COX-2, ximenynic acid exerted a greater effect on COX-1, with
PGE2 is the product of arachidonic acid metabolism by COXs (
Vascular endothelial growth factor (VEGF)-B and VEGF-C are two members of the VEGF family that induce angiogenesis and inhibit apoptosis (
Numerous factors modulate angiogenesis in cancer. The current study investigated the expression of several angiogenesis-associated genes including chemokine (C-C motif) ligand 2 (
Ximenynic acid is one of main components of sandalwood seed fatty acids, and remains to be fully investigated. Sandalwood is widely used in perfume, artwork, furniture and for religious reasons, however, the sandalwood tree is a slow-growing plant and requires decades or even centuries for full growth. For the sustainable development of the sandalwood industry, it the value of the sandalwood seed should be investigated.
Sandalwood seeds are rich in oil, and the main fatty acids of the oil are oleic acid and ximenynic acid. The structure of oleic acid is very similar to ximenynic acid, excluding a triple bond. The anti-inflammatory and anti-cancer properties of oleic acid are inferior compared with ximenynic acid, which suggests that the conjugated enyne structure of ximenynic acid is crucial for the medicinal properties. Thus, ximenynic acid may be the key functional factor of sandalwood seed oil. In addition, numerous acetylenic fatty acids exert important pharmacological functions, including antibacterial (
Ximenynic acid induced G1/G0 phase arrest in HepG2 cells and inhibited the expression of
Ximenynic acid induced HepG2 cell apoptosis and inhibited SIRT1 expression. SIRT1 has been previously reported to inhibit cellular senescence and suppress cell apoptosis (
Ximenynic acid selectively inhibited COX-1 expression, however it exhibited no effect on COX-2. Typically, ximenynic acid has been previously used for anti-inflammatory treatment and decreases the activity of COXs (
The anti-cancer activity of ximenynic acid is predominantly attributed to the inhibition of COX-1, which may be associated with histone acetylation modification (
The anti-cancer activity of ximenynic acid may be associated with the cell cycle, angiogenesis and cell apoptosis pathways. The putative pathways of ximenynic acid are presented in
This work was supported by a grant from the National Program on Key Basic Research Project of China (973 Program; grant no. 2015CB553600).
Cell viability analysis of HepG2 cells with XA or OA treatment by methyl thiazolyl tetrazolium assay. Variation curves of cell viability by XA or OA treatment with different concentrations ranging from 0–150 µM. Values are expressed as the mean ± standard deviation; n=3. *P<0.05 vs. the vehicle group. OA, oleic acid; XA, ximenynic acid.
Ximenynic acid induced apoptosis of HepG2 cells. (A) Cell apoptosis analysis of HepG2 cells treated with ximenynic acid or oleic acid at different concentrations by flow cytometry. (B) Levels of early apoptosis cells in the different groups. (C) Levels of alive cells in the different groups. (D) Caspase-3 protein expression in different groups. O50 and O150 groups were treated with oleic acid at 50 and 150 µM, respectively. X50 and X150 groups were treated with ximenynic acid at 50 and 150 µM, respectively. Values are expressed as the means ± standard deviation; n=3. *P<0.05 vs. the vehicle group.
The expression of fold change of SIRT1 protein in HepG2 cells following fatty acids treatment. Cells were incubated with ximenynic acid or oleic acid at two concentrations (50 and 150 µM) and with vehicle medium for 72 h. O50 and O150 groups were treated with oleic acid at 50 and 150 µM, respectively. X50 and X150 groups were treated with ximenynic acid at 50 and 150 µM, respectively. Data are presented as the mean ± standard deviation; n=3. *P<0.05 vs. the vehicle group. SIRT1, silent information regulator T1.
The effects of ximenynic acid or oleic acid treatment on cell cycle distribution and expression of cell cycle related genes and protein. Flow cytometry analysis of HepG2 cells treated with vehicle, ximenynic acid or oleic acid by staining with propidium iodide. Variations of cell cycle distributions in the (A) G0/G1, (B) S, and (C) G2/M phases were determined. Expression fold changes of (D)
Influence of ximenynic acid or oleic acid treatments on the cyclooxygenase pathway. (A)
Expression variations of angiogenesis-associated genes in HepG2 cells following fatty acids treatment. Following incubation with ximenynic acid or oleic acid for 72 h, the expression of angiogenesis-associated genes including (A)
The putative pathways of ximenynic acid-induced anticancer activity. The anticancer activity of ximenynic acid may associate with cell cycle, angiogenesis and cell apoptosis pathways by inhibition of COX-1, GCN5L2 and SIRT1 proteins, and COX-1 may be the key factor of this pathway. GCN5L2, general control of amino acid synthesis yeast homolog like 2; COX,-1 cyclooxygenase; SIRT1, silent information regulator T1; VEGF, vascular endothelial growth factor.
Primers used for reverse transcription-quantitative polymerase chain reaction analysis.
Protein | Gene symbol | Accession no. | Forward primer (5′-3′) | Reverse primer (5′-3′) | Product length (bp) |
---|---|---|---|---|---|
Cyclin D3 | CCND3 | NM_001287427 | CATGAACTACCTGGATCGCTAC | GCCAGGAAATCATGTGCAATC | 243 |
Cyclin E1 | CCNE1 | NM_001238 | ACTCAACGTGCAAGCCTCG | GCTCAAGAAAGTGCTGATCCC | 141 |
Cyclooxygenase 1 | PTGS1 | NM_000962 | TTCAATGAGTACCGCAAGAGG | GAAGCAGTCCAGGGTAGAAC | 139 |
Cyclooxygenase 2 | PTGS2 | NM_000963 | CAAGACAGATCATAAGCGAGGG | GTCTAGCCAGAGTTTCACCG | 92 |
Prostaglandin E receptor 2 | EP2 | NM_000956 | CCTCATTCTCCTGGCTATCATG | CTTTCGGGAAGAGGTTTCATTC | 94 |
Prostaglandin E receptor 4 | EP4 | NM_000958 | ATCTTACTCATTGCCACCTCC | TGACTTCTCGCTCCAAACTTG | 106 |
Vascular endothelial growth factor B | VEGF-B | NM_003377 | CTTAGAGCTCAACCCAGACAC | ACCCTGCTGAGTCTGAAAAG | 76 |
Vascular endothelial growth factor C | VEGF-C | NM_005429 | GGCTGGCAACATAACAGAGA | GTGGCATGCATTGAGTCTTT | 136 |
Chemokine (C-C Motif) ligand 2 | CCL2 | NM_002982 | TGTCCCAAAGAAGCTGTGATC | ATTCTTGGGTTGTGGAGTGAG | 150 |
Hypoxia-inducible factor-1α | HIF-1α | NM_001243084 | GAAAACTTGGCAACCTTGGA | AAATCTCCGTCCCTCAACCT | 196 |
High Mobility Group Box 1 | HMGB1 | NM_002128 | CCATTGGTGATGTTGCGAAG | TCAGGCTTTCCTTTAGCTCG | 145 |
Transforming growth factor β1 | TGF-β1 | NM_000660 | TTCAACACATCAGAGCTCCG | TGAGGTATCGCCAGGAATTG | 145 |
Ribosomal protein, large, P0 | RPLP0 |
NM_001002 | GAAACTCTGCATTCTCGCTTC | GGTGTAATCCGTCTCCACAG | 150 |
Reference gene.