D-limonene has been demonstrated to have important immunomodulatory properties, including antitumor effects, and may alleviate asthma and allergies. In the present study, the anti-inflammatory effects of D-limonene were investigated in an ulcerative colitis (UC) rat model. Healthy male Sprague-Dawley rats were randomly divided into control, untreated UC, and treatment with 50 or 100 mg/kg D-limonene UC groups. In UC rats, disease activity and colonic mucosa damage were significantly reduced by the anti-inflammatory effects of D-limonene, via suppression of matrix metalloproteinase (MMP)-2 and −9 gene expression. In addition, treatment with D-limonene significantly increased antioxidant, inducible nitric oxide synthase (iNOS) and cyclooxygenase-2 (COX-2) protein expression levels in UC rats. A decrease in prostaglandin E2 (PGE2) production, transforming growth factor-β (TGF-β) gene expression and an increase phosphorylated-extracellular signal regulated kinase (ERK) 1/2 expression levelswere observed in UC rats treated with D-limonene. In conclusion, D-limonene reduced MMP-2 and −9 mRNA expression levels via regulation of the iNOS, COX-2, PGE2, TGF-β and ERK1/2 signaling pathways in a UC rat model, indicating its potential antioxidant and anti-inflammatory properties.
Ulcerative colitis (UC) is a non-specific type of inflammation with an unknown cause. Lesions exhibit continuous and diffuse distribution, primarily in the rectum and sigmoid colon of the large intestine (
UC has numerous similarities with infectious enteritis and can cause microbial inflammation of the intestinal tract (
2,4,6-trinitrobenzenesulfonic acid solution and D-limonene were obtained from Sigma-Aldrich; Merck KGaA (Darmstadt, Germany). Tumor necrosis factor-α (TNF-α; R019), interleukin (IL)-1β (H002), IL-6, nuclear factor-κB (NF-κB; H202), superoxide dismutase (SOD; A001-3), glutathione (GSH; A006-2) and prostaglandin (PG) E2ELISA kits were obtained from the Nanjing Jiancheng Bioengineering Institute (Jiangsu, China). A bicinchoninic acid (BCA) assay kit was obtained from Fermentas; Thermo Fisher Scientific, Inc. (Waltham, MA, USA).
Healthy male Sprague-Dawley rats (weight, 220–300 g; age, 8–10 weeks; n=32) were purchased from Changzhou Cavens Laboratory Animal Co., Ltd. (Changzhou, China), housed at 23–24°C, 50–60% humidity, light/dark cycle (7:00-19:00) with free access to food and water, and randomly divided into control, UC model, and treatment with 50 or 100 mg/kg D-limonene groups (n=8/group). The control group rats were subjected to enema and oral gavage with normal saline. The UC model was established by administration of 2% DSS for 7 days. For the D-limonene-treated groups, UC model rats were administered with 50 or 100 mg/kg D-limonene by gastric lavage for 7 days (
Body weight, stool consistency, behavior and fecal blood in the stools of the rats were recorded daily. The scores were assigned as follows: Body weight reduction (0, no alteration; 1, 1–5%; 2, 6–10%; 3, 11–15%; 4, >15%); stool consistency (0, typical; 2, loose; 4, diarrhea); and the presence of fecal blood (0, typical; 2, positive occult blood test; 4, visible bleeding). The DAI was calculated as the sum of these scores. The entire colon was excised from the cecum of rats, and macroscopic damage was evaluated using the CMDI scoring system (
Serum was obtained from a peripheral vessel and centrifuged at 1,200 × g for 10 min at room temperature. Serum protein expression levels of TNF-α, IL-1β, IL-6, NF-κB, SOD, GSH and PGE2 were measured using ELISA kits, and the absorbance was measured at a wavelength of 450 nm using an ELISA reader.
Total RNA was extracted from colonic mucosa tissue samples using TRIzol® reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Equal quantities of total RNA were used to synthesize cDNA using an RNA Polymerase Chain Reaction (PCR) kit (Avian Myeoblastosis Virus 3.0; Takara Biotechnology Co., Ltd., Dalian, China), according to the manufacturer's protocol. Following this, quantitative PCR (qPCR) was performed using a SYBR®-Green JumpStart™ Taq ReadyMix™ (Sigma-Aldrich; Merck KGaA), SYBR®-Green PCR Master mix (Applied Biosystems; Thermo Fisher Scientific, Inc.) and iCycler IQ™ Real-Time PCR Detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). The sequences for gene-specific primers are presented in
For western blot analysis, colonic mucosa tissue samples were obtained and homogenized with radioimmunoprecipitation assay buffer (EMD Millipore, Billerica, MA, USA). The homogenate was centrifuged at 1200 × g for 10 min at 4°C and protein concentrations were measured using a BCA assay kit. A total of 50 mg protein underwent 10% SDS-PAGE and was subsequently transferred onto nitrocellulose membranes (Merck KGaA). The membranes were blocked with 5% (w/v) non-fat milk powder in Tris-buffered saline containing 0.1% Tween-20 (TBST), followed by incubation at 4°C overnight with the appropriate primary antibody at the following dilutions: Anti-iNOS (sc-649; 1:2,000; Santa Cruz Biotechnology, Inc., Dallas, TX, USA), anti-COX-2 (sc-7951; 1:1,000; Santa Cruz Biotechnology, Inc.) and anti-phosphorylated (p)-ERK1/2 (sc-101760; 1:2,000, Santa Cruz Biotechnology, Inc.), with anti-β-actin (D110007; 1:5,000; Sangon Biotech, Co., Ltd., Shanghai, China) serving as the internal control. Following this, membranes were washed three times in TBST for 1 h and incubated with horseradish peroxidase (HPR)-conjugated anti-rabbit IgG secondary antibodies for 2 h at room temperature (sc-2004; 1:5,000; Santa Cruz Biotechnology, Inc.). Proteins were detected using a SuperSignal™ West Femto Chemiluminescent Substrate (Thermo Fisher Scientific, Inc.) and calculated using Image-Pro Plus software version 3.0 (Media Cybernetics, Inc., Silver Spring, MD, USA).
Data were analyzed by one-way analysis of variance, followed by Student-Newman-Keuls post hoc test, using SPSS version 22.0 (IBM SPSS, Armonk, NY, USA). Data are expressed as the mean ± standard deviation. P<0.05 was considered to indicate a statistically significant difference.
In the UC model group, DAI (
Expression levels of the inflammatory cytokines NF-κB (
mRNA expression levels of MMP-2 (
Activities of SOD (
As presented in
UC rats exhibited increased protein expression levels of COX-2 compared with control rats (P=0.0078;
The effect of D-limonene on PGE2 production was assessed in UC rats. There was a significant increase in PGE2 production in UC rats compared with the control group (P=0.0012;
The effect of D-limonene on TGF-β gene expression in UC rats is presented in
To assess the effects of D-limonene on the ERK1/2 signaling pathway, p-ERK1/2 protein expression levels were measured. Western blot analysis revealed that p-ERK1/2 protein expression levels were significantly reduced in UC rats compared with control rats (P=0.0058;
UC is a type of inflammatory bowel disease. It is hypothesized that the pathogenesis of UC involves the activation of the immune system by various microbial antigens, based on genetic material and environmental factors. This results in an imbalance of cytokines, which activates a variety of inflammatory cells and recruits these cells to the site of inflammation, releasing further inflammatory cytokines and thus leading to chronic inflammation of the colon (
During the process of oxidation, a variety of highly chemically reactive oxygen species may be generated, which leads to intestinal tissue damage and ulceration. The oxygen free radical scavenging capacity of UC patients is decreased, therefore exacerbating disease (
COX-2 is expressed at low levels in healthy mucosa and during UC remission; however, its expression levels are significantly increased in active UC. It is primarily expressed in epithelial, endothelial and inflammatory cells (
PGE2, a type of PG, is a metabolite of the 20-carbon unsaturated fatty acid AA (
TGF-β is a cytokine with a variety of physiological functions. Mothers against decapentaplegic (SMAD) proteins are signaling molecules within cells that may be activated by the compound generated by TGF-β and its receptor, which additionally transmits the signals into the nucleus (
ERK is an important member of the mitogen-activated protein kinase (MAPK) system, which serves important roles in the mediation of inflammatory responses and the regulation of inflammatory cytokine production, the promotion of epithelial cell proliferation and differentiation, and the inhibition of intestinal epithelium apoptosis (
In conclusion, the present study demonstrated the that D-limonene suppresses MMP-2 and −9 mRNA expression levels via regulation of the iNOS, COX-2, PGE2, TGF-β and ERK1/2 signaling pathways in a UC rat model, indicating its potential antioxidant and anti-inflammatory properties. The current study indicates that D-limonene may be a novel potential target for the therapeutic effects of UC.
The chemical structure of D-limonene.
Disease activity index and colonic mucosa damage index scores. Quantification of (A) disease activity index and (B) colonic mucosa damage in ulcerative colitis rats, following treatment with 50 or 100 mg/kg D-limonene. Data are presented as the mean ± standard deviation. **P<0.05 vs. control group; ##P<0.05 vs. model group. Control, control group; model, ulcerative colitis model; 50, 50 mg/kg D-limonene treated group; 100, 100 mg/kg D-limonene treated group.
Inflammatory cytokines. Protein expression levels of (A) NF-κB p65 subunit, (B) TNF-α, (C) IL-1β and (D) IL-6 in ulcerative colitis rats, following treatment with 50 or 100 mg/kg D-limonene. Control, control group; model, ulcerative colitis model; 50, 50 mg/kg D-limonene treated group; 100, 100 mg/kg D-limonene treated group. Data are presented as the mean ± standard deviation. **P<0.05 vs. control group; ##P<0.05 vs. model group. IL, interleukin; TNF-α, transforming growth factor-α; NF-κB, nuclear factor κB.
MMP-2 and MMP-9 gene expression. Quantification of (A) MMP-2 and (B) MMP-9 mRNA expression levels in ulcerative colitis rats, following treatment with 50 or 100 mg/kg D-limonene. Data are presented as the mean ± standard deviation. **P<0.05 vs. control group; ##P<0.05 vs. model group. MMP, matrix metalloproteinase; Control, control group; model, ulcerative colitis model; 50, 50 mg/kg D-limonene treated group; 100, 100 mg/kg D-limonene treated group.
Antioxidant activity. Quantification of (A) SOD and (B) GSH activities in ulcerative colitis rats, following treatment with 50 or 100 mg/kg D-limonene. Data are presented as the mean ± standard deviation. **P<0.05 vs. control group; ##P<0.05 vs. model group. SOD, superoxide dismutase; GSH, glutathione; Control, control group; model, ulcerative colitis model; 50, 50 mg/kg D-limonene treated group; 100, 100 mg/kg D-limonene treated group.
iNOS protein expression levels. (A) Representative western blot images and (B) quantification of iNOS protein expression levels in ulcerative colitis rats, following treatment with 50 or 100 mg/kg D-limonene. β-actin served as an internal control. Data are presented as the mean ± standard deviation. **P<0.05 vs. control group; ##P<0.05 vs. model group. iNOS, inducible nitric oxide synthase; Control, control group; model, ulcerative colitis model; 50, 50 mg/kg D-limonene treated group; 100, 100 mg/kg D-limonene treated group.
COX-2 protein expression levels. (A) Representative western blot images and (B) quantification of COX-2 protein expression levels in ulcerative colitis rats, following treatment with 50 or 100 mg/kg D-limonene. β-actin served as an internal control. Data are presented as the mean ± standard deviation. **P<0.05 vs. control group; ##P<0.05 vs. model group. COX-2, cyclooxygenase 2; Control, control group; model, ulcerative colitis model; 50, 50 mg/kg D-limonene treated group; 100, 100 mg/kg D-limonene treated group.
PGE2 production. Quantification of PGE2 protein expression levels in ulcerative colitis rats, following treatment with 50 or 100 mg/kg D-limonene. Data are presented as the mean ± standard deviation. **P<0.05 vs. control group; ##P<0.05 vs. model group. PGE2, prostaglandin E2; Control, control group; model, ulcerative colitis model; 50, 50 mg/kg D-limonene treated group; 100, 100 mg/kg D-limonene treated group.
TGF-β gene expression. Quantification of TGF-β mRNA expression levels in ulcerative colitis rats, following treatment with 50 or 100 mg/kg D-limonene. Data are presented as the mean ± standard deviation. **P<0.05 vs. control group; ##P<0.05 vs. model group. Control, control group; model, ulcerative colitis model; 50, 50 mg/kg D-limonene treated group; 100, 100 mg/kg D-limonene treated group; TGF-β, transforming growth factor-β.
p-ERK1/2 protein expression levels. (A) Representative western blot images and (B) quantification of p-ERK1/2 protein expression levels in ulcerative colitis rats, following treatment with 50 or 100 mg/kg D-limonene. β-actin served as an internal control. Data are presented as the mean ± standard deviation. **P<0.05 vs. control group; ##P<0.05 vs. model group. Control, control group; model, ulcerative colitis model; 50, 50 mg/kg D-limonene treated group; 100, 100 mg/kg D-limonene treated group; ERK 1/2, extracellular signal regulated kinase; p, phosphorylated.
Primers used in the present study.
Gene | Sequence (5′-3′) | Product size (bp) |
---|---|---|
MMP-2 | F: ACCATCGCCCATCATCAAGT | 348 |
R: CGAGCAAAAGCATCATCCAC | ||
MMP-9 | F: CCCTGCGTATTTCCATTCAT | 600 |
R: ACCCCACTTCTTGTCAGCGTC | ||
TGF-β | F: TGCTTCAGCTCCACAGAGAA | 284 |
R: TGGTTGTAGAGGGCAAGGAC | ||
β-actin | F: AAGCCTAAGGCCAACCGTGAAAAG | 241 |
R: TCAATGAGGTAGTCTGTCAGGT |
MMP, matrix metalloproteinase; TGF, transforming growth factor-β; F, forward; R, reverse.