The adult human prostatic epithelial cell line RWPE-1 and human PCa lines PC-3, DU-145 and LNCAP were all purchased from the Chinese Academy of Sciences (Shanghai, China). The RWPE-1 cell lines were cultured in keratinocyte-serum-free medium (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 25 mg bovine pituitary extract (13028–014) and 2.5 µg recombinant human epidermal growth factor (10450–013; both Invitrogen; Thermo Fisher Scientific, Inc.). Other PCa lines were all cultured in RPMI 1640 medium (Invitrogen; Thermo Fisher Scientific, Inc.), supplemented with 10% fetal bovine serum, 100 IU/ml penicillin and 100 mg/ml streptomycin (Invitrogen; Thermo Fisher Scientific, Inc.).

The sequence of the miR-186-containing flank region was amplified from human genomic DNA using polymerase chain reaction (PCR) and inserted into pCDH-CMV-EF1-GFP+puro (System Biosciences, Mountain View, CA, USA). In order to generate an miR-186-expressing stable cell line, a lentivirus-mediated packaging system containing four plasmids, pCDH-miR-186 or control plasmid, pMDL, REV and VSVG, at the ratio (quantity) of 5:5:2:3, was created. The transfection and lentiviral infection processes were performed according to those previously described (12). In order to downregulate miR-186 in the PC-3 cells, an miR-186 inhibitor synthesized by Guangzhou RiboBio Co., Ltd. (Guangzhou, China) was used according to the manufacturer's instructions.

For the construction of human CDK6, YY1, vascular endothelial growth factor A (VEGFA) and mitogen-activated protein kinase kinase kinase 2 (MAP3K2) 3′-UTR wild-type and mutant region luciferase reporters, the indicated 3′-UTR regions were amplified from HEK293T cDNA using PCR amplification with the primerstar polymerase (Takara Biotechnology Co., Ltd., Dalian, China) and the appropriate primers (see List of primers used for the construction of luciferase reporters). The resultant PCR fragments were cloned into the pMIR-report vector (Promega Corporation, Madison, WI, USA) using the SpeI and HindIII sites.

hCDK6 3′-UTR forward, AAGCTGCGCACTAGTCATTCAAGGTCAGGTCTACT and reverse, TCCTTTATTAAGCTTACAACTACACCGATGGAAG; hCDK6 3′-UTR-Mut forward, GAATTTTTCAGCATTGGGGAGAATTTTAAATGAGTAGAG and reverse, CTCATTTAAAATTCTCCCCAATGCTGAAAAATTCCAGTT; hYY1 3′-UTR forward, AAGCTGCGCACTAGTGCATCTTCCAGAAGTGTGA and reverse, TCCTTTATTAAGCTTCGTAGCATTACTAAGCATATCC; hYY1 3′-UTR-Mut forward, CATCAAAAGACAATTGGGGATACAACAGTGCTAAAAATG and reverse, TTAGCACTGTTGTATCCCCAATTGTCTTTTGATGCGAAG; hMAP3K2 3′-UTR forward, AAGCTGCGCACTAGTCCTCTATCACTGACACATCA and reverse, TCCTTTATTAAGCTTGCAGAAAGCTATCCCTCAA; and hVEGFA 3′-UTR forward, TAAAATATATATATTGGGGTTTTAAATTAACAGTGCTAA and reverse, ACTGTTAATTTAAAACCCCAATATATATATTTTATATAT.

Total RNA was obtained using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.) and the enriched miRNA molecules were prepared with an E.Z.N.A.^® miRNA kit (Omega Bio-Tek, Inc., Norcross, GA, USA) according to the manufacturer's instructions. For miRNA reverse transcription, cDNA was obtained using a Thermo Scientific^® RevertAid^® First Strand cDNA Synthesis kit (Thermo Fisher Scientific, Inc.) with 100 ng total mRNA. Furthermore, mRNA was reverse transcribed using an RT-PCR kit (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. qPCR was performed with primers for miR-186, CDK6, MAP3K2, nuclear receptor coactivator 2 (NCOA2), VEGFA, PMEPA, RB binding protein 9 (RBBP9), X-linked inhibitor of apoptosis protein (XIAP), transforming growth factor β receptor 2 (TGFβR2), YY1 and folate hydrolase 1 (FOLH1) using SYBR Green PCR Master Mix (Invitrogen; Thermo Fisher Scientific, Inc.) in a real-time PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.) following a standard qPCR procedure, as follows: Denaturation at 95°C for 5 min; followed by 38 cycles of 95°C for 30 sec, 58°C for 30 sec and 72°C for 20 sec; and a final step of 72°C for 7 min. The primer sequences used were the following: miR-186, 5′-GCGGCGGCAAAGAATTCTCC-3′ and 3′-ATCCAGTGCAGGGTCCGAGG-5′; CDK6, 5′-CACCCCAACGTGGTCAGGTT-3′ and 3′-TTCAGTGGGCACTCCAGGCT-5′; MAP3K2, 5′-AACAGAATGATGTCCGAG-3′ and 3′-ATAGACTGTCCAAAGGCA-5′; NCOA2, 5′-AGAGACAAGAAAGCGCAA-3′ and 3′-TTCCTGTTCACGATTACG-5′; VEGFA, 5′-CACGGTCCCTCTTGGAAT-3′ and 3′-ATGTGGGTGGGTGTGTCT-5′; PMEPA, 5′-TCGGAGAGCACAGTGTCA-3′ and 3′-TGCAGGTACGGATAGGTG-5′; RBBP9, 5′-CTGCCCTTCATGGAGACA-3′ and 3′-TCCCCCAAGTCTGATGTG-5′; XIAP, 5′-AGGAGCAGCTTGCAAGAG-3′ and 3′-GTCTTCACTGGGCTTCCA-5′; TGFBR2, 5′-TGTGATGTGAGATTTTCCAC-3′ and 3′-GCAAACTGTCTCTAGTGTTATG-5′; YY1, 5′-CAACAAGAAGTGGGAGCA-3′ and 3′-CCACTGTCTCATGGTCAA-5′ and FOLH1, 5′-TTCTATGAAACATCCACAGG-3′ and 3′-GTTGCTTTTGTCAAAGTCCT-5′. The relative quantification was performed by normalizing against the levels of glyceraldehyde 3-phosphate dehydrogenase for mRNA or U6 for miRNA. For mutation type of CDK6 and YY1, QuickChange PCR was performed, as follows: Denaturation at 94°C for 3 min; followed by 16 cycles of 94°C for 30 sec, 56–60°C for 2 min and 68°C for 10 min; and a final step of 68°C for 30 min.

HEK293T, purchased from the Chinese Academy of Sciences (Shanghai, China), or PC-3 cells were seeded into a 24-well plate and co-transfected with miR-186 or control and 3′-UTR-luciferase plasmids. The cells were then lysed 48 h post-transfection, and the luciferase activity was measured using a Dual-Glo Luciferase Assay System (Promega Corporation, Madison, WI, USA) and normalized against renilla luciferase activity. Each treatment was performed in triplicate in three independent experiments.

HEK293T and PC-3 cells were lysed, proteins were extracted and western blotting was performed, as previously described (13). Equal amounts of cell lysates (15 µg) were fractionated by size on a 10% SDS-polyacrylamide gel (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) and transferred onto polyvinylidene fluoride membranes (EMD Millipore, Billerica, MA, USA). The membrane was blocked with tris-buffered saline-Tween with 5% non-fat milk at room temperature for 1 h. Samples were then incubated with antibodies against the following proteins: YY1 (CST-2185S; 1:2,000; Cell Signaling Technology, Inc., Danvers, MA, USA), CDK6 (D155263; 1:1,000; Sangon Biotech Co., Ltd., Shanghai, China) and β-actin (MABT825; 1:10,000; EMD Millipore) at 4°C overnight. Subsequently, horseradish peroxidase-labeled goat anti-rabbit (ab6721; 1:10,000; Abcam, Cambridge, MA, USA) and goat anti-mouse (ab6789; 1:10,000; Abcam) secondary polyclonal antibodies were added, respectively, followed by immobilon enhanced chemiluminescence (EMD Millipore).

For cell cycle analysis, PC-3 cells were harvested 72 h after transfection, and then measured using a cell cycle staining kit (Multi Sciences Biotech Co., Ltd., Hangzhou, China) according to the manufacturer's instructions and using flow cytometry. The percentage of cells in the G0/G1, S and G2/M phases of the cell cycle are presented in the results. All experiments were performed in triplicate and repeated three times with similar results.

For the cell proliferation assay, the cell suspension (2,000 cells/well) was inoculated in a 96-well plate. After 2 or 3 days of transfection, 10 µl cell counting kit-8 (CCK8) solution (Dojindo Molecular Technologies, Inc., Kumamoto, Japan) was added into each well. Next, the cell suspension was incubated for 4 h and the absorbance was measured at 450 nm using a microplate reader.

All experimental protocols were approved and the methods were performed in accordance with the Guidelines of the Animal Care and Use Committee of Xiamen University (Xiamen, China). A total of 8 specific-pathogen-free (SPF) mice were obtained from Xiamen University Laboratory Animal Center (Xiamen, China). All SPF mice were housed in a standard animal facility under standard conditions (temperature, 20–23°C; humidity, 55±5%; 12-h light/dark cycle) and had access to the same normal diet and water ad libitum, meeting the SPF system required. For the tumor growth assay, 1×10⁶ PC-3/pCDH and PC-3/miR-186 cells were injected into the subcutaneous of 6-week-old male nude mice (weight, 16–18g; n=4 mice/group) and tumor growth was detected. All mice were sacrificed after 28 days using carbon dioxide euthanasia. Tumors were then resected and measured.

Candidate target genes for miR-186 were searched for using TargetScan (targetscan.org), miRanda (microrna.org) and miRwalk (zmf.umm.uni-heidelberg.de). The relationship between the candidate target genes and PCa was also investigated using published articles in the PubMed database (ncbi.nlm.nih.gov/pubmed).

All the experiments were performed at least three times, and all of the results were expressed as the mean ± standard deviation. Statistical analysis was performed by Student's t-test using SPSS v. 16.0 software (SPSS, Inc., Chicago, IL, USA). P<0.05 was used to indicate a statistically significant difference.

Previous results have demonstrated that the expression of miR-186 in PCa specimens was downregulated compared with the corresponding non-malignant specimens and benign prostatic hyperplasia (BPH) samples, and that this was inversely correlated with the clinicopathological parameters (11). In order to define the expression of miR-186 in prostate cell lines, miR-186 expression levels were detected in the RWPE-1 cell line and three PCa cell lines (PC-3, DU145 and Lncap). As shown in Fig. 1, the miR-186 expression was significantly decreased in the PCa cell lines in comparison with RWPE-1, and it was the lowest in PC-3, which was selected for further overexpression studies. These results indicated that miR-186 expression is frequently downregulated in PCa cell lines and that this may be involved in the development of PCa.

The progression of cancer depends on the malignant proliferation of cancer cells to some degree. To calculate the biological function of miR-186 in PCa, the PCa cell line PC-3 that has the lowest miR-186 expression, was stably infected with a pCDH-miR-186 lentivirus, and pCDH was used to act as a negative control (Fig. 2A). miR-186 overexpression increased the percentage of cells in the G0/G1 phase and decreased the percentage of cells in the S phase (Fig. 2B). Furthermore, the CCK8 assays implied that the ectopic overexpression of miR-186 suppressed the proliferation of PC-3 cells (Fig. 2C).

To test whether miR-186 can suppress tumor growth of PCa cells in vivo, nude mice were randomly assigned in two groups and received subcutaneous injection of PC-3/miR-186 and PC-3/pCDH cells. In total, 4 weeks after injection, the mice injected with PC-3/miR-186 cells displayed evidently smaller tumors compared with the mice injected with PC-3/pCDH cells (Fig. 3A). Additionally, the mice injected with PC-3/pCDH cells displayed significantly increased weight compared with that of mice injected with PC-3/miR-186 cells (Fig. 3B and C). These data demonstrate that, consistent with the in vitro data of the present study, miR-186 inhibits the tumor growth of PCa cells in vivo.

To determine the potential mechanism by which miR-186 suppresses the tumor growth of PCa cells, four in silico algorithms (Targetscan, miRanda, and miRwalk) were used to forecast the target genes of miR-186 (14), and these potential candidates were obtained, including CDK6, MAP3K2, NCOA2, VEGFA, PMEPA, RBBP9, XIAP, TGFBR2, YY1 and FOLH1. The majority of these candidates are irregularly expressed in PCa compared with normal tissue or related to cell proliferation (15–17). Next, RT-qPCR was used to detect the expression of these target genes in PC-3/pCDH or PC-3/miR-186. The expression of YY1, CDK6, VEGFA and MAP3K2 were found to be decreased >30% upon ectopic miR-186 overexpression in PC-3 cells (Fig. 4A). Next, the wild type or mutant 3′-UTRs of YY1, CDK6, VEGFA and MAP3K2 were cloned into luciferase constructs to define whether miR-186 can directly bind to these genes. As shown in Fig. 4B, the overexpression of miR-186 conspicuously decreased the luciferase activity of YY1 and CDK6 by 40–45% compared to the controls. Additionally, these miR-186 binding sites in the 3′-UTRs of YY1 and CDK6 were obliterated by QuickChange PCR (18). However, it was revealed that the mutant binding sites of miR-186 in the target genes YY1 and CDK6 3′-UTRs abolished the miR-186-mediated inhibitory effect on the luciferase activity (Fig. 4C). Western blot analyses were also performed to obtain the expression levels of the YY1 and CDK6 protein. As shown in Fig. 4D, the levels of YY1 and CDK6 were evidently decreased in PC-3/miR-186 cells compared with PC-3/pCDH cells. All of these data imply that YY1 and CDK6 are direct targets of miR-186 in PCa cells.