Fanconi Anemia (FA) is an autosomal recessive syndrome characterized by congenital abnormalities, progressive bone marrow failure and Fanconi anemia complementation group A (
Breast cancer is the most common type of invasive cancer in women and accounts for 16% of all female cancers, with the second highest mortality rate among women worldwide (
The Fanconi anemia complementation group A (
A total of 304 breast cancer cases were systematically ascertained through Imam Khomeini Hospital Complex (Tehran University of Medical Sciences, Tehran, Iran). Of these cases, 50% (152) were selected on the basis of a family history of breast cancer (defined as ≥2 cases of breast cancer in a first- or second-degree female relative). Blood was taken from all recruits who consented to molecular analysis for breast cancer predisposition genes at the Central Laboratory of Imam Khomeini Hospital Complex hospital. The age range of the all breast cancer participants was 28–74 with a mean age of 49.41±10.44 years (familial and non-familial breast cancer). The controls were selected from the same population from which the cases arose and consisted of 295 healthy female volunteers who were attending the Cancer Institute of Imam Khomeini Hospital Complex for a checkup. The age range of the controls was 28–74 with a mean age of 49.28±10.48 years. None of the control individuals had any history of breast cancer or any other neoplastic diseases, and had no family history of breast cancer diagnosed at the same clinics. Women with hysterectomy and artificial menopause, or who had been exposed to any kind of radiation, including X-rays, or chemotherapy in their life time were excluded from the study. Control and cancer groups were drawn from the same geographical area. Demographical and epidemiological risk factor data was collected from a short, structured questionnaire, which included information on age at menarche, age at menopause, marriage status, race, age at breast cancer onset, number of pregnancies and children, age at first child birth and average lactation term. An ongoing protocol to collect and store blood samples for future genomic tests was approved by the institutional review board and appropriate ethics committee. Peripheral blood was collected and genotyping analysis was performed for selected regions in the
The study was approved by the Research Ethics Committee for Tehran University of Medical Sciences (
DNA for genotyping was prepared from the peripheral blood sample of patients and controls. The DNA promoter region containing the duplication (164 bp) was amplified using primers designed by Primer3 (version 0.4.0) software and positive control primers were used to amplify estrogen receptor 1 gene exon 4 (329 bp), as published elsewhere (
DNA was isolated using AccuPrep® (high pure phenol-chloroform) Genomic DNA extraction kit (Bioneer Corporation; Takapouzist Co., Tehran, Iran). Lysis buffer (200 µl) was added to 200 µl whole blood and incubated at 60°C for 10 min, 500 µl phenol was then added and centrifuged at 12,000 ×
The following was added to each 50 µl PCR reaction tube: 43.5 µl master mix (5X HOT FIREPol® Blend; TAG Copenhagen A/S, Frederiksberg, Denmark); 2 µl (200 nM) primers synthesized by TAG Copenhagen A/S; 2 µl (50 ng) DNA template (extracted genomic DNA); and 2.52 µl Taq DNA polymerase (0.5 U Super Taq enzymes; Cambridge Bioscience, Ltd., Cambridge, UK) and PCR was performed in an Eppendorf thermo-cycler following the protocol in
The Hardy-Weinberg equilibrium was assessed by the standard methods (
Variation in the
A single set of primers was used to amplify both alleles by PCR in the promoter region (
To the best of our knowledge, the present study was the first to evaluate the association between variations in the
As even single base changes in gene sequences may change gene expression regulation and lead to tumorigenesis, particularly if this affects a transcription factor binding site (
Genotyping of the promoter polymorphism indicated a significant difference in the allele or genotype distribution between patients with breast cancer and normal controls. The present study had 80% power to detect an OR ≥1.27 for heterozygous carriers of the duplication and an OR ≥1.511 for homozygous carriers of the duplication in hereditary breast cancer. Furthermore, the frequency of the allele 1 was significantly higher in patients with a family history of breast cancer compared with the control group (45 and 21%, respectively; P=0.001), indicating that allele 1 may increase the risk of breast cancer development. Nevertheless, larger studies are required to compare the frequency of
The current study was supported by Tehran University of Medical Sciences and Health Services (grant no. 91-01-31-14816).
Genotyping the Fanconi anemia complementation group A promoter polymorphism by polymerase chain reaction. Allele 0 amplifies as a band of 151 bp and allele 1 as a band of 164 bp. All 3 genotypes are readily distinguishable on a 3% agarose gel run at 100 V for 1 h. Lane 1, ladder; lane 2, estrogen receptor 1 exon 4 gene, positive control; lanes 3,4,7 and 8, 00 homozygote; lane 5, 01 heterozygote; and lane 6, 11 homozygote. bp, base pairs.
Polymerase chain reaction primers.
Primer | Sequence 5′→3′ | Base pairs |
---|---|---|
Duplicated region |
F: CCAAACGCAAAAACTACCTCACCG | 164 |
R: CGCTGCCTTCCTATTGGCTGC | ||
F: ACCTGTGTTTTCAGGGATACGA | 329 | |
R: GCTGCGCTTCGCATTCTTAC |
Polymerase chain reaction cycling conditions.
Step number | Reaction | Temperature (°C) | Duration (min) | Number of cycles |
---|---|---|---|---|
1 | Primary denaturation | 94 | 4 | 1 |
2 | Denaturation | 94 | 1 | 35 |
3 | Annealing | 67 | 1 | 35 |
4 | Extension | 72 | 1 | 35 |
5 | Final extension | 72 | 5 | 2 |
The distribution of Fanconi anemia complementation group A gene promoter polymorphism genotypes and estimated risk in breast cancer cases and controls.
Study group | ||||
---|---|---|---|---|
Group | 00 | 01 | 11 | P-value |
Control (%) | 190 (64.4) | 85 (28.8) | 20 (6.8) | |
All breast cancer cases | 0.001 | |||
Number (%) | 131 (43.1) | 131 (43.1) | 42 (13.8) | |
OR (95% CI) | 1.0 | 2.235 (1.57–3.17) | 3.046 (1.71–5.424) | |
Familial breast cancer cases | 0.001 | |||
Number (%) | 43 (28.3) | 81 (53.3) | 28 (18.4) | |
OR (95% CI) | 1.0 | 1.27 (0.825–1.955) | 1.511 (0.73–3.131) | |
Non-familial breast cancer cases | 0.365 | |||
Number (%) | 88 (57.9) | 50 (32.9) | 14 (9.2) | |
OR (95% CI) | 1.0 | 4.211 (2.686–6.601) | 6.186 (3.189–11.998) |
OR and CI for 01 and 11 groups are presented relative to that of 00. 00, normal genotype; 01, duplication heterozygote; 11, duplication homozygote; OR, odds ratio; CI, confidence interval.
The distribution of Fanconi anemia complementation group A promoter polymorphism allelic frequencies in familial and non-familial breast cases compared with controls.
Study group | Allele 0(%) | Allele 1(%) | P-value | χ2 |
---|---|---|---|---|
All breast cancer cases | 393 (46.6) | 215 (53.4) | 0.001 | 29.6 |
Control | 465 (78.8) | 125 (21.2) | ||
Familial breast cancer | 167 (54.9) | 137 (45.1) | 0.001 | 55.21 |
Control | 465 (78.8) | 125 (21.2) | ||
Non-familial breast cancer | 226 (74.3) | 78 (25.7) | 0.131 | 2.286 |
Control | 465 (78.8) | 125 (21.2) |
P-values indicate comparisons between the number of individuals with allele 0 and allele 1. 0, normal single copy allele; 1, duplication allele.
Estimated risk of breast cancer for major risk factors in different genotypes.
Genotype | |||||
---|---|---|---|---|---|
Category | All | 01 | 11 | 00 | P-value |
Age at menarche | 0.001 | ||||
≤12 years (%) | 220 | 100 (76.3) | 16 (38.1) 26 (61.9) | 104 (80.6) | |
>12 years (%) | 82 | 31 (23.7) | 26 (61.9) | 25 (19.4) | |
OR (95% CI) | 0.775 (0.428–1.405) | 0.148 (0.069–0.316) | 1 | ||
Age at breast cancer onset | 0.335 | ||||
≤40 years (%) | 118 | 57 (44.2) | 14 (34.1) | 47 (36.4) | |
>40 years (%) | 181 | 72 (55.8) | 27 (65.9) | 82 (63.6) | |
OR (95% CI) | 1.381 (0.838- 2.276) | 0.905 (0.432–1.893) | 1 | ||
Age at menopause | 0.693 | ||||
≤50 years (%) | 39 | 20 (27.8) | 5 (19.2) | 14 (25.5) | |
>50 years (%) | 114 | 52 (72.2) | 21 (80.8) | 41 (74.5) | |
OR (95% CI) | 1.126 (0.508–2.497) | 0.697 (0.221–2.199) | 1 | ||
Metastasis status | 0.348 | ||||
Yes (%) | 37 | 14 (10.8) | 8 ( |
15 (11.6) | |
No (%) | 264 | 116 (89.2) | 34 (81) | 114 (88.4) | |
OR (95% CI) | 0.917 (0.423–1.987) | 1.788 (0.699–4.576) | 1 | ||
Cancer status | 0.001 | ||||
Familial (%) | 152 | 81 (61.8) | 28 (66.7) | 43 (32.8) | |
Non-familial (%) | 152 | 50 (38.2) | 14 (33.3) | 88 (67.2) | |
OR (95% CI) | 3.315 (1.996–5.506) | 4.093 (1.957–8.561) | 1 |
OR and CI for 01 and 11 groups are presented relative to that of 00. 00, normal genotype; 01, duplication heterozygote; 11, duplication homozygote; OR, odds ratio; CI, confidence interval.