Molecular Medicine Reports Molecular Medicine Reports 1791-2997 1791-3004 D.A. Spandidos 10.3892/mmr.2017.6494 mmr-15-06-4382 Articles UDP and NTF2 are the most consistently expressed genes in Panax ginseng roots at different growth stages LiuMeichen WangQun XieHongmei LiuShichao WangSiming ZhangHui ZhaoYu Center of Chinese Medicine and Bio-Engineering Research, Changchun University of Chinese Medicine, Changchun, Jilin 130117, P.R. China Correspondence to: Professor Yu Zhao, Center of Chinese Medicine and Bio-Engineering Research, Changchun University of Chinese Medicine, 1035 Boshuo Road, Changchun, Jilin 130117, P.R. China, E-mail: cnzhaoyu1972@126.com 062017 21042017 15 6 4382 4390 04012016 19122016 Copyright © 2017, Spandidos Publications 2017

Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis relies on normalization against a consistently expressed reference gene. However, it has been reported that reference gene expression levels often vary markedly between samples as they are usually selected based solely on convention. The advent of RNA sequencing technology offers the opportunity to select reference genes with the least variability in steady-state transcript levels. To identify the most consistently stable genes, which are a prerequisite for obtaining reliable gene expression data, the present study analyzed transcriptomes from six Panax ginseng transcriptome data sets, representing six growth stages, and selected 21 candidate reference genes for screening using RT-qPCR. Of the 21 candidate genes, 13 had not been reported previously. The geNorm, NormFinder and BestKeeper programs were used to analyze the stability of the 21 candidate reference genes. The results showed that UDP-N-acetylgalactosamine transporter and nuclear transport factor 2 were likely to be the optimal combination of reference genes for use in investigations of ginseng. The novel reference genes were validated by correlating the gene expression profiles of four pathogenesis-related protein genes generated from RT-qPCR, with their expression levels calculated from the RNA sequencing data. The expression levels were well correlated, which demonstrated their value in performing RT-qPCR analyses in ginseng.

 Panax ginseng RNA sequencing reverse transcription-quantitative polymerase chain reaction reference gene Introduction

Ginseng (Panax ginseng CA Meyer) is a medicinal herb, which has been used in Asia for >1,000 years (1). Ginseng root, the most commonly used region of the plant, contains bioactive constituents with complex and multiple pharmacological effects (2). Previous reports have demonstrated that ginseng grown for longer durations shows improved efficacy and a greater concentration of bioactive components, including ginsenosides (3–6). Various studies have focused on the genetics underlying these findings, particularly on marker gene identification or authentication, and on key enzymes involved in the ginsenoside biosynthetic pathway (7,8). However, the molecular mechanisms remain to be fully elucidated.

Gene expression analysis is an effective and widely used approach to identify marker genes and elucidate biological mechanisms. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) analysis is the preferred method for gene expression analysis owing to its rapidity, sensitivity and specificity (9). Measurements of the expression levels of genes of interest are normalized against a consistently expressed reference gene to improve the accuracy of the RT-qPCR results. However, reference genes are usually selected based solely on convention, and reference gene levels have been found to vary substantially among samples (10–13). In previous studies analyzing gene expression in ginseng, reference genes, predominantly actin 1 (ACT1) and 18S rRNA, have been selected based on previous studies of various plant species (14–18). However, it has been shown that the expression levels of these two genes are not consistent in different ginseng organs (19). Thus, the selection of suitable reference genes is an important prerequisite for gene expression analysis in ginseng.

RNA sequencing (RNA-Seq) is an ideal method to identify the most consistently expressed genes for use as reference genes (20), as large-scale gene expression data can be generated at the same time and gene expression values can be converted to reads per kilobase of transcript per million (RPKM) (21) for direct comparisons between gene data sets. Publically available RNA-Seq data have been used previously to identify superior reference genes (21–24). In the present study, RNA-Seq data was obtained from our previous ginseng RNA-Seq sequencing project, which included a panel of six ginseng transcriptome databases, and were used to identify reference genes with lower variations across multiple developmental stages in ginseng root. Statistical methods were implemented in geNorm (25), NormFinder (26) and BestKeeper (27), and the effectiveness of the candidate genes for RT-qPCR normalization were then compared with traditional reference genes.

 Materials and methods <sec> <title>Ginseng samples

P. ginseng CA Meyer plants were used in the present study. The P. ginseng samples, which had been grown for 3, 5, 7, 10, 15 and 20 years, were originally collected from Fu-song County (longitude, 127.28; latitude, 42.33) of Jilin, China. A single sample was harvested for each growth period. The primary roots were collected, immediately frozen in liquid nitrogen and stored at −80°C until used for library construction.

 Selection of candidate reference genes from ginseng RNA-Seq data

The RNA-Seq data were generated on an Illumina sequencing platform (HiSeq 2,000; Illumina, Inc., San Diego, CA, USA), as described previously (28). Briefly, the samples from the six growing stages were processed according to the manufacturer's protocol and used for transcriptome analysis, including cDNA library construction, sequencing, assembly and gene expression analyses.

Gene expression levels were expressed as RPKM using the following formula: RPKM=109C/NL, where C is the number of mappable reads uniquely aligning to a unigene, N is the total number of mappable reads that uniquely align to all unigenes, and L is the length of a unigene in base pairs. Candidate reference genes were selected by calculating the coefficient of variation (CV) and the maximum fold change (MFC) across multiple samples within each data set, where CV represents the standard deviation (SD) divided by the mean RPKM, and MFC represents the maximum RPKM divided by the minimum RPKM value.

 RT-qPCR analysis

Total RNA was isolated using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's protocol. The RT-qPCR analyses were performed using the One Step SYBR PrimeScript PLUS RT-qPCR kit (Takara Biotechnology, Co., Ltd. Dalian, China, TaKaRa code: DRR096A). The PCR amplification was performed in a 25 µl mixture containing 2.0 µl cDNA, 0.5 µl each primer, 12.5 µl SYBR Premix Ex Taq, 0.5 µl ROX reference dye II and 9 µl distilled water. Data were collected using an ABI Prism 7500 real-time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The thermal cycling conditions comprised an initial denaturation step at 95°C for 30 sec and 40 cycles at 95°C for 5 sec and 65°C for 34 sec, followed by a dissociation stage at 95°C for 15 sec, 60°C for 1 min and 95°C for 15 sec. All samples were amplified in triplicate and the mean was used for RT-qPCR analysis. Relative gene expression was calculated using the 2−ΔΔCq method (29). The primer sequences were designed using Primer 6.0 software (www.premierbiosoft.com/primerdesign/index.html) (30).

 Stability analysis of candidate reference genes

The mRNA expression profiling data sets were prepared and generated from the RNA-Seq data. To compare the stability of the candidate reference genes, the following three Visual Basic for Applications were used for Microsoft Excel: GeNorm (https://genorm.cmgg.be/), NormFinder (http://moma.dk/normfinder-software) and BestKeeper (http://www.gene-quantification.de/bestkeeper.html).

 Expression analysis of pathogenesis-related (PR) proteins

To determine whether RT-qPCR normalization with different reference genes altered the expression profiles, PR proteins were used to validate candidate reference genes. The genes and their primers are listed in Table I. The ΔCq values for each sample were calculated using either a traditional reference gene (ACT1) or a novel reference gene (UDP-N-acetylgalactosamine transporter; UDP) or the combination of UDP and nuclear transport factor 2 (NTF2), as identified by geNorm. All these analyses were performed in compliance with Minimum Information for Publication of Quantitative Real-Time PCR Experiments guidelines (31).

 Results <sec> <title>Construction of RNA-Seq databases

The RNA-Seq data used in the present study were obtained from our ginseng project, which covered six growing stages between 3 and 20 years. The data included >39,000,000 high-quality sequencing reads for each sample. Following reads clustering, >80,000 unigenes were obtained in each data set, which comprises the gene sequence, gene expression level, annotation and other information for each unigene.

CV and MFC values were used to estimate the stability of the RPKM values in order to select candidate reference genes expressed at moderate or high levels in all six data sets, based on the following three criteria: %CV <25, MFC <5, mean RPKM >100. As a result, 21 candidate reference genes were identified; these comprised eight traditional reference genes: ACT1, glyceraldehyde-3-phosphate dehydrogenase (GAPDH), 18s rRNA, ubiquitin (UBQ), tubulin, β-tubulin, cyclophilin (CYP), and PP2Ac-3-phosphatase 2A isoform 3 (PP2A), and 13 non-traditional reference genes: Ubiquitin conjugating enzyme isoform 2 (UBE2), GAGA-binding transcriptional activator (GAGA) protein disulfide isomerase (PDI), mitochondrial-processing peptidase (MPP), glucose-6-phosphate (G6P); UDP, probable prefoldin subunit 5 (PPS); auxin response factor 1 (ARF1), putative 3-isopropylmalate dehydrogenase (3-IPMDH), δ(3,5)-δ(2,4)-dienoyl-CoA isomerase, mitochondrial (ECH1), eukaryotic translation initiation factor 4E-1 (EIF-4E1), SKP1 and NTF2. A summary of the sequence information for these genes is provided in Table II.

 Expression profiles of the candidate reference genes

The expression profiles of the 21 candidate reference genes in the RNA-Seq data sets across the six growth stages were analyzed. The 21 genes were ranked from lowest to highest CV values based on the RPKMs (Fig. 1), which allowed direct comparisons within and between samples with no bias for short genes. The results showed that the non-traditional reference genes, UDP, NTF2 and UBE2, were the most stably expressed genes, whereas traditional reference genes, including ACT1, GAPDH and 18s rRNA, were less consistently expressed in the six growth stages.

Subsequently, the expression profiles of the 21 candidate reference genes were determined using RT-qPCR analysis. The Cq values for individual genes reflect the actual mRNA levels in the samples and can be compared directly. The Cq distribution is shown as a box-plot in Fig. 2. The average Cq values for the 21 genes ranged between 15 and 29 cycles, with the majority falling between 20 and 26 cycles. Consistent with the results from the analysis of the RNA-Seq data, the non-traditional UDP, NTF2, and UBE2 reference genes had more consistent Cq values, compared with the traditional reference genes.

 Statistical analysis of RT-qPCR data using geNorm, NormFinder and BestKeeper

The consistency of the expression levels of each reference gene was analyzed using the geNorm, NormFinder and BestKeeper software packages.

geNorm was designed to analyze the expression stability of candidate reference genes based on the assumption that the ratio of the expression levels of two ideal reference genes is constant in all samples. The average expression stability (M value), for each reference gene is calculated using the average of pairwise variations, according to which the expression stability of all reference genes is ranked. The least stable gene, which has the highest M value, is then excluded and the M value is recalculated in a stepwise manner until the two most stably expressed genes are identified (32). The geNorm analyses of all six samples revealed that the UDP and NTF2 combination had the lowest M value (0.18), whereas GAGA had the highest M value (0.58; Fig. 3). geNorm also calculates the pairwise variation (Vn/Vn+1) between two sequential normalization factors, NFn and NFn+1, to determine the optimum number of reference genes. As a general rule, the stepwise inclusion of reference genes is performed until Vn/Vn+1 falls below a theoretical threshold of 0.15, when the benefit of adding another gene (n+1) is limited (25,33). In the present study, the pairwise variation V2/3 was below the default cut-off value of 0.15, which indicated that the inclusion of a third reference gene was not necessary. Thus, UDP/NTF2 may be the most suitable combination of reference genes for gene expression analyses in ginseng at different growth stages (Fig. 4).

The present study also used NormFinder to rank the expression stability of the 21 candidate reference genes. NormFinder uses an analysis of variance-based model to estimate intra- and inter-group variations, and combines these estimates to provide a direct measure of the variations in expression for each gene (26). Genes with lower average expression stability values are more stably expressed. NormFinder analyses of all six samples revealed that UDP was the most stable gene, followed by ECH1, which surpassed that of UBE2, whereas GAGA was the least stable (Table III).

The BestKeeper program analyzes the stability of a candidate reference gene based on the CV and standard deviation (SD) of Cq values using the average Cq value of each duplicate reaction (27). Reference genes, which exhibit the lowest CV±SD, are determined as the most stable genes. The BestKeeper analyses revealed that UBE2 and UDP showed the highest expression stability in all six samples (Table IV), whereas GAGA and tubulin showed the least stable expression. Although the preferred reference genes differed marginally for each program, UDP consistently ranked high in expression stability.

 Consensus list of candidate reference genes

To provide a consensus result from the outputs of the three statistical programs, an arithmetic mean ranking value was calculated for each gene to obtain the final gene stability ranking order (Table V). The results revealed that UDP, NTF2 and UBE2 were the most stable reference genes, whereas tubulin, CYP and GAGA were the least stable.

 Validation of the usefulness of the selected reference genes

Validation of the sets of candidate reference genes involved normalizing the RT-qPCR expression levels of the genes encoding four PR proteins (PR1, PR2, PR5 and PR10) in the six growing stages. To survive under different environmental stresses, ginseng has developed mechanisms to perceive external signals, which trigger adaptive responses and appropriate physiological alterations, with the induction of PR proteins being one such response (34). PR proteins have been classified into 17 families on the basis of structural differences, serological associations and biological activity (35).

In accordance with the results obtained from the RNA-Seq data sets, the alterations in gene expression levels of the PR proteins showed similar patterns when the UDP/NTF2 combination (from geNorm) and the most consistent reference gene, UDP, were used for normalization. However, significantly different gene expression levels were observed for the PR proteins when the traditional reference gene, ACT1, was used for normalization. Spearman's correlation analysis also demonstrated a high degree of correlation between RPKM and relative quantification when the UDP/NTF2 combination or UDP were used as reference genes, and a low degree of correlation when ACT1 was used (Fig. 5).

These results showed that the choice of reference gene had a considerable effect on the normalization results, and that using inappropriate reference genes may introduce bias to the analysis and cause misleading results.

 Discussion

Using inaccurate reference genes for normalization can lead to conflicting results in gene expression investigations based on RT-qPCR analysis, particularly when transcription rate variations between sample groups are small (36). Increasing evidence indicates that traditional reference genes do not show stable expression under all conditions (27,37). Therefore, it is important to validate the expression stability of a reference gene under specific experimental conditions prior to use in RT-qPCR normalization.

The present study performed systematic analysis of the stability of mRNA expression levels of 21 candidate reference genes, including eight traditional reference genes from six ginseng transcriptome data sets. RNA-Seq data and three independent methods, geNorm, NormFinder and BestKeeper, were used to identify suitable reference genes for differential gene expression analyses during ginseng growth years. Among the 21 candidate reference genes analyzed, UDP and NTF2 were determined to be the optimal combination of reference genes for analyzing expression.

Microarray and large-scale sequencing technologies have been used to identify stably expressed reference genes (38). RNA-Seq technology is considered a method technology for the following reasons: i) RNA-Seq reads are digital rather than analog; ii) there is low background signal; and iii) there is virtually no upper limit for detection results in a substantially larger dynamic range (20,21,39–42). A higher degree of technical reproducibility with RNA-Seq, compared with microarrays has been reported, and RNA-Seq expression data correlate well with RT-qPCR data, regardless of the sequencing platform used (39,41).

As a single software package may introduce bias, three statistical approaches, geNorm, NormFinder and BestKeeper, were used in the present study to determine the stability of the expression of the 21 candidate reference genes. GeNorm and BestKeeper identified UDP, NTF2 and UBE2 as the genes with the least variation, and NormFinder identified UDP, ECH1 and UBE2 as the genes with the highest expression stabilities. Inconsistencies between the three methods can be expected, as they use different statistical algorithms (43). To summarize the results, a comprehensive ranking order of each reference gene was calculated, and it was found that the reference gene with the highest stability was the combination of UDP and NTF2.

UDP, a novel nucleotide sugar transporter with dual substrate specificity, is important in the development of plants, and may also be involved in glucuronidation and chondroitin sulfate biosynthesis (44). NTF2 is indispensable in plants, as it facilitates protein transport into the nucleus. It may be a component of a multicomponent system of cytosolic factors, which assemble at the pore complex during nuclear import (45,46). These two reference genes exhibited similar expression patterns in the six growth stages of ginseng, possibly due to them being involved in basic cell metabolism and cellular functions. In addition to their high expression stability, the superiority of UDP and NTF2 over the traditional reference genes was based on their lower expression levels. The use of reference genes with low expression levels similar to the target genes has been recommended in order for the comparisons to fall on the same linear scale (47). The data obtained in the present study supported the unsuitability of the traditional reference genes, including ACT1, for normalization, which was in accordance with other studies (48,49). The reference genes selected in the present study may be superior reference genes for the normalization of a wide range of genes, particularly weakly expressed genes. This result is significant as the majority of transcripts in tissues are expressed at low levels (50).

The results of the present study revealed that the expression levels normalized by a single top-ranked reference gene were less accurate, compared with expression levels normalized using two reference genes. Therefore, for investigations of ginseng development and growth, it is recommended that two reference genes are used for reliable quantification.

In conclusion, the present study used RNA-Seq data to identify 21 candidate reference genes in ginseng root grown for different durations, and identified UDP and NTF2 as the most suitable reference genes using geNorm, NormFinder and BestKeeper. These genes were validated using RT-qPCR analysis for use as reference genes in ginseng investigations. The results showed that the use of unsuitable reference genes for normalization may result in biased expression levels. These findings are useful for further gene expression analyses of ginseng growth, particular associated with marker identification, environmental stress and the characterization of gene function. In addition, the results of the present study provide useful guidelines for reference gene selection in investigations of other species.

 Acknowledgements

This study was supported by grants from the National Natural Foundation of China (grant nos. 81373937 and 81503212), the Scientific and Technological Development Program of Jilin, China (grant nos. 20140622003JC and 20150520139JH) and the Strategic Adjustment of the Economic Structure of Jilin Province to Guide the Capital Projects (grant no. 2014N155).

 Abbreviations UDP

UDP-N-acetylgalactosamine transporter

 NTF2

nuclear transport factor 2

 RT-qPCR

reverse transcription- quantitative polymerase chain reaction

 RNA-Seq

RNA sequencing

 RPKM

reads per kilobase of transcript per million

 UBE2

ubiquitin conjugating enzyme isoform 2

 GAGA

GAGA-binding transcriptional activator

 PDI

protein disulfide isomerase

 MPP

mitochondrial-processing peptidase

 G6P

glucose-6-phosphate

 PPS

probable prefoldin subunit 5

 ARF1

auxin response factor 1

 3-IPMDH

putative 3-isopropylmalate dehydrogenase

 ECH1

δ(3,5)-δ(2,4)-dienoyl-CoA isomerase, mitochondrial

 EIF-4E1

eukaryotic translation initiation factor 4E-1

 ACT1

actin 1

 GAPDH

glyceraldehyde-3-phosphate dehydrogenase

 UBQ

ubiquitin

 CYP

cyclophilin

 PP2A

PP2Ac-3-phosphatase 2A isoform 3

 References XiangYZShangHCGaoXMZhangBLA comparison of the ancient use of ginseng in traditional chinese medicine with modern pharmacological experiments and clinical trialsPhytother Res22851858200810.1002/ptr.2384 JamesADThe Green Pharmacy Herbal Handbook: Your comprehensive reference to the best herbs for healingRodale: Emmaus, USA1151162000 DanMXieGGaoXLongXSuMZhaoAZhaoTZhouMQiuYJiaWA rapid ultra-performance liquid chromatography-electrospray Ionisation mass spectrometric method for the analysis of saponins in the adventitious roots of Panax notoginsengPhytochem Anal206876200910.1002/pca.1099 ShanSMLuoJGHuangFKongLYChemical characteristics combined with bioactivity for comprehensive evaluation of Panax ginseng C.A. Meyer in different ages and seasons based on HPLC-DAD and chemometric methodsJ Pharm Biomed Anal897682201410.1016/j.jpba.2013.10.030 WanJYFanYYuQTGeYZYanCPAlolgaRNLiPMaZHQiLWIntegrated evaluation of malonyl ginsenosides, amino acids and polysaccharides in fresn and processed ginsengJ Pharm Biomed Anal1078997201510.1016/j.jpba.2014.11.014 HeJMZhangYZLuoJPZhangWJMuQVariation of ginsenoside in ginseng of different agesNat Prod Commun117397402016 SathiyarajGSrinivasanSSubramaniumSKimYJKimYJKwonWSYangDCPolygalacturonase inhibiting protein: Isolation, developmental regulation and pathogen related expression in Panax ginseng C.A. MeyerMol Biol Rep3734453454201010.1007/s11033-009-9936-1 HanJYKimHJKwonYSChoiYEThe Cyt P450 enzyme CYP716A47 catalyzes the formation of protopanaxadiol from dammarenediol-II duringginsenoside biosynthesis in Panax ginsengPlant Cell Physiol5220622073201110.1093/pcp/pcr150 BustinSAQuantification of mRNA using real-time reverse transcription PCR (RT-PCR): Trends and problemsJ Mol Endocrinol292339200210.1677/jme.0.0290023 ThellinOZorziWLakayeBDe BormanBCoumansBHennenGGrisarTIgoutAHeinenEHousekeeping genes as internal standards: Use and limitsJ Biotechnol75291295199910.1016/S0168-1656(99)00163-7 BustinSAAbsolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assaysJ Mol Endocrinol25169193200010.1677/jme.0.0250169 SchmittgenTDZakrajsekBAEffect of experimental treatment on housekeeping gene expression: Validation by real-time, quantitative RT-PCRJ Biochem Biophys Methods466981200010.1016/S0165-022X(00)00129-9 LeePDSladekRGreenwoodCMHudsonTJControl genes and variability: Absence of ubiquitous reference transcripts in diverse mammalian expression studiesGenome Res12292297200210.1101/gr.217802155273 HuangZLinJChengZXuMGuoMHuangXYangZZhengJProduction of oleanane-type sapogenin in transgenic rice via expression of β-amyrin synthase gene from Panax japonicas C. A. MeyBMC Biotechnol1545201510.1186/s12896-015-0166-44450844 LimWShimMKKimSLeeYRed ginseng represses hypoxia-induced cyclooxygenase-2 through sirtuin1 activationPhytomedicine22597604201510.1016/j.phymed.2015.03.005 OhGSYoonJLeeGGOhWKKimSW20 (S)-protopanaxatriol inhibits liver X receptor α-mediated expression of lipogenic genes in hepatocytesJ Pharmacol Sci1287177201510.1016/j.jphs.2015.05.007 QiJSunPLiaoDSunTZhuJLiXTranscriptomic analysis of american ginseng seeds during the dormancy release process by RNA-SeqPLoS One10e0118558201510.1371/journal.pone.01185584366157 ZhuLLiJXingNHanDKuangHGePAmerican ginseng regulates gene expression to protect against premature ovarian failure in ratsBiomed Res Int2015767124201510.1155/2015/7671244330957 LiuJWangQSunMZhuLYangMZhaoYSelection of reference genes for quantitative real-time PCR normalization in Panax ginseng at different stages of growth and in different organsPLoS One9e112177201410.1371/journal.pone.01121774230945 MortazaviAWilliamsBAMcCueKSchaefferLWoldBMapping and quantifying mammalian transcriptomes by RNA-SeqNat Methods5621628200810.1038/nmeth.1226 WangZGersteinMSnyderMRNA-Seq: A revolutionary tool for transcriptomicsNat Rev Genet105763200910.1038/nrg24842949280 MacraeTSargeantTLemieuxSHébertJDeneaultESauvageauGRNA-Seq reveals spliceosome and proteasome genes as most consistent transcripts in human cancer cellsPLoS One8e72884201310.1371/journal.pone.00728843775772 Cankorur-CetinkayaADereliEEraslanSKarabekmezEDikiciogluDKirdarBA novel strategy for selection and validation of reference genes in dynamic multidimensional experimental design in yeastPLoS One7e38351201210.1371/journal.pone.00383513366934 de JongeHJFehrmannRSde BontESHofstraRMGerbensFKampsWAde VriesEGvan der ZeeAGte MeermanGJter ElstAEvidence based selection of housekeeping genesPLoS One2e898200710.1371/journal.pone.00008981976390 VandesompeleJDe PreterKPattynFPoppeBVan RoyNDe PaepeASpelemanFAccurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genesGenome Biol3research0034200210.1186/gb-2002-3-7-research0034126239 AndersenCLJensenJLØrntoftTFNormalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data setsCancer Res6452455250200410.1158/0008-5472.CAN-04-0496 PfafflMWTichopadAPrgometCNeuviansTPDetermination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper--Excel-based tool using pair-wise correlationsBiotechnol Lett26509515200410.1023/B:BILE.0000019559.84305.47 YaoBZhaoYZhangHZhangMLiuMLiuHLiJSequencing and de novo analysis of the Chinese Sika deer antler-tip transcriptome during the ossification stage using Illumina RNA-Seq technologyBiotechnol Lett34813822201210.1007/s10529-011-0841-z LivakKJSchmittgenTDAnalysis of relative gene expression data using real-time quantitative PCR and the 2(−Delta Delta C(T)) methodMethods25402408200110.1006/meth.2001.1262 RozenSSkaletskyHPrimer3 on the WWW for general users and for biologist programmersMethods Mol Biol1323653862000 BustinSABenesVGarsonJAHellemansJHuggettJKubistaMMuellerRNolanTPfafflMWShipleyGLThe MIQE guidelines: Minimum information for publication of quantitative real-time PCR experimentsClin Chem55611622200910.1373/clinchem.2008.112797 Pombo-SuarezMCalazaMGomez-ReinoJJGonzalezAReference genes for normalization of gene expression studies in human osteoarthritic articular cartilageBMC Mol Biol917200810.1186/1471-2199-9-172248200 WarzybokAMigockaMReliable reference genes for normalization of gene expression in cucumber grown under different nitrogen nutritionPLoS One8e72887201310.1371/journal.pone.00728873772881 GibbsGMRoelantsKO'BryanMKThe CAP superfamily: Cysteine-rich secretory proteins, antigen 5, and pathogenesis-related 1 proteins-roles in reproduction, cancer and immune defenseEndocr Rev29865897200810.1210/er.2008-0032 SelsJMathysJDe ConinckBMCammueBPDe BolleMFPlant pathogenesis-related (PR) proteins: A focus on PR peptidesPlant Physiol Biochem46941950200810.1016/j.plaphy.2008.06.011 EtschmannBWilckenBStoevesandKvon der SchulenburgASterner-KockASelection of reference genes for quantitative real-time PCR analysis in canine mammary tumors using the GeNorm algorithmVet Pathol43934942200610.1354/vp.43-6-934 HuisRHawkinsSNeutelingsGSelection of reference genes for quantitative gene expression normalization in flax (Linum usitatissimum L.)BMC Plant Biol1071201010.1186/1471-2229-10-713095345 HamalainenHKTubmanJCVikmanSKyröläTYlikoskiEWarringtonJALahesmaaRIdentification and validation of endogenous reference genes for expression profiling of T helper cell differentiation by quantitative real-time RT-PCRAnal Biochem2996370200110.1006/abio.2001.5369 OshlackARobinsonMDYoungMDFrom RNA-seq reads to differential expression resultsGenome Biol11220201010.1186/gb-2010-11-12-2203046478 ManeSPEvansCCooperKLCrastaORFolkertsOHutchisonSKHarkinsTTThierry-MiegDThierry-MiegJJensenRVTranscriptome sequencing of the microarray quality control (MAQC) RNA reference samples using next generation sequencingBMC Genomics10264200910.1186/1471-2164-10-2642707382 WilhelmBTLandryJRRNA-Seq-quantitative measurement of expression through massively parallel RNA-sequencingMethods48249257200910.1016/j.ymeth.2009.03.016 ShendureJThe beginning of the end for microarrays?Nat Methods5585587200810.1038/nmeth0708-585 JianBLiuBBiYHouWWuCHanTValidation of internal control for gene expression study in soybean by quantitative real-time PCRBMC Mol Biol959200810.1186/1471-2199-9-592443375 MuraokaMKawakitaMIshidaNMolecular characterization of human UDP-glucuronic acid/UDP-N-acetylgalactosamine transporter, a novel nucleotide sugar transporter with dual substrate specificityFEBS Lett4958793200110.1016/S0014-5793(01)02358-4 BaylissRRibbeckKAkinDKentHMFeldherrCMGörlichDStewartMInteraction between NTF2 and xFxFG-containing nucleoporins is required to mediate nuclear import of RanGDPJ Mol Biol293579593199910.1006/jmbi.1999.3166 GoepfertSVidoudezCRezzonicoEHiltunenJKPoirierYMolecular identification and characterization of the Arabidopsis delta(3,5), delta(2,4)-dienoyl-coenzyme A isomerase, a peroxisomal enzyme participating in the beta-oxidation cycle of unsaturated fatty acidsPlant Physiol13819471956200510.1104/pp.105.0643111183386 CzechowskiTStittMAltmannTUdvardiMKScheibleWRGenome-wide identification and testing of superior reference genes for transcript normalization in ArabidopsisPlant Physiol139517200510.1104/pp.105.0637431203353 GoidinDMamessierAStaquetMJSchmittDBerthier-VergnesORibosomal 18S RNA prevails over glyceraldehyde-3-phosphate dehydrogenase and beta-actin genes as internal standard for quantitative comparison of mRNA levels in invasive and noninvasive human melanoma cell subpopulationsAnal Biochem2951721200110.1006/abio.2001.5171 SelveySThompsonEWMatthaeiKLeaRAIrvingMGGriffithsLRBeta-actin: An unsuitable internal control for RT-PCRMol Cell Probes15307311200110.1006/mcpr.2001.0376 WarringtonJANairAMahadevappaMTsyganskayaMComparison of human adult and fetal expression and identification of 535 housekeeping/maintenance genesPhysiol Genomics21431472000

Variation coefficient of reads per kilobase of transcript per million. The horizontal axis lists the candidate reference genes; the vertical axis is the variation coefficient. The lower the variable coefficient, the higher the stability.

Box and whisker plots of Cq values for the 21 candidate reference genes in six growth stages. Expression data is shown as the Cq value for each reference gene in all ginseng samples. The data are expressed as whisker box plots; the box represents the 25th-75th percentiles. The median is indicated by the bar across the box, and the whiskers on each box represent the minimum and maximum values.

Ranking of candidate reference genes by geNorm. The expression stability of the candidate reference genes was evaluated using geNorm. The M value was determined by assessing the mean pairwise variations of all genes; the least stable gene, with the highest M value, was excluded, and the M value was recalculated until the most stable pair was selected. M, stability.

Determination of the optimal number of reference genes. The geNorm program calculated an NF and used the variable, V, to determine pairwise variation (Vn/Vn+1) between two sequential NFs (NFn and NFn+1). Additional genes were included when V exceeded the cut off value, which is typically set at 0.15, but is not always achievable. The number of reference genes is considered optimal when the lowest possible V value is achieved, at which point it is unnecessary to include additional genes in the normalization strategy. NF, normalization factor; V, variation.

Expression profiles of PR proteins. The RQ of PR proteins were determined using reverse transcription-quantitative polymerase chain reaction analysis, calculated using the 2−ΔΔCq method with either ACT1 or UDP and NTF2 as the reference gene, relative to the 3-year-old ginseng sample. For UDP and NTF2, the geometric mean was calculated and used for normalization. RQ, relative quantification; RPKM, reads per kilobase of transcript per million mapped reads obtained for each ginseng sample by RNA-seq; PR, pathogenesis-related; ACT1, actin 1; UDP, UDP-N-acetylgalactosamine transporter; NTF2, nuclear transport factor 2.

Primer sequences and amplicon sizes of PR proteins.

Symbol Gene name Primer sequence (5′→3′) Amplicon size (bp)
PR1 Pathogenesis-related protein 1 TGTTTCCTTCCTCCCTCG 145
CCCCTTCGCTGATTGGT
PR2 Pathogenesis-related protein 2 GCTCCATCCTCAGTCCCA 132
GGTTCCAACTCCACCATCTC
PR5 Pathogenesis-related protein 5 CCATTTTCCTTTTCATTTCCA 147
CGTTAATGGTCCAGGTTTGG
PR10 Pathogenesis-related protein 10 TTGAAGCACTGGATTGATGAG 134
CCACCATTGGATGATGCC

Panax ginseng candidate reference genes, primers and amplicon sizes.

Symbol Gene name Primer sequence (5′→3′) Amplicon size (bp)
UBE2 Ubiquitin-conjugating enzyme isoform 2 AGTGCTGGACCTGTTGGTGAAG 112
CTGGTGGGAAATGAATGGATAC
GAGA GAGA-binding transcriptional activator BBR/BPC AATGAGTAGCGGGGTTGATGAC 132
CCTCCATTTCCCCATTTGTAGC
PDI Protein disulfide isomerase GCAGACAAAGATAGCCCATTCC 173
AAGGCAACAAAGCAGATGGCAG
MPP Mitochondrial-processing peptidase CGACCTAAGGAACCACAATCAG 121
CTTCCTTCACATTATGCCAGCC
G6P Glucose-6-phosphate TGAAGGGGAAGTCTGTTAGTGG 121
TTCCATCCAAGTGCCCACATCT
UDP UDP-N-acetylgalactosamine dual transporter CGGCAAGCAGAGATAAGACACT 95
CGGCAAGCAGAGATAAGACACT
PPS Probable prefoldin subunit 5 AGCAGTAAAGGAACAAACCGAT 159
ACATAAAGCGACGCCGTAAGAG
ARF1 Auxin response factor 1 GAGCGTGGAGAAAAAGGTATTG 142
GCTTCAACTGATAAATGCGACC
3-IPMDH Putative 3-isopropylmalate dehydrogenase TCCCGCTATCTTCGTGTCTTCT 105
GGATAGGTTGGGAAATGAAGGT
ECH1 δ(3,5)-δ(2,4)-dienoyl-CoA isomerase, mitochondrial AATCTCTTCCTCAATCGCCCAT 130
ATTAGGGTTTTGGTCAAGGGAG
EIF-4E1 Eukaryotic translation initiation factor 4E-1 TATTCCACATCCACTTGAGCAC 111
GAAGAGAAAGTGTAGATGGGGC
SKP1 Skp1 CGCTAACACCAGTATTCCCCTT 214
GATGTTGAGGTAGTTTGCTGCC
NTF2 Nuclear transport factor 2 AGAACATCGTTGCCAAACTCAC 112
CTGACAAAGACGAGCATACCAC
ACT1 Actin 1 TGGCATCACACTTTCTACAACG 109
TTTGTGTCATCTTCTCCCTGTT
GAPDH Glyceraldehyde-3-phosphate dehydrogenase, cytosolic GAGAAGGAATACACACCTGACC 106
CAGTAGTCATAAGCCCCTCAAC
18s rRNA 18S rRNA TTCACACCAAGTATCGCATTTC 145
CCAAGGAAATCAAACTGAACTG
UBQ Ubiquitin, putative AACCAACTGATACCATTGACCG 120
CTTTTGCTGTTTTGTCATCTCC
Tublin Tubulin α-1 chain CTCTGTTGTTGGAACGCTTGTC 144
CTGTGTGCTCAAGAAGGGAATG
β-Tublin β-tubulin TGTTGTGAGGAAAGAAGCCGAG 165
GGAGAAGGGAAGACAGAGAAAG
CYP Cyclophilin CAGGCAAAGAAAAAGTCAAGTG 108
AAAGAGACCCATTACAATACGC
PP2A PP2Ac-3-phosphatase 2A isoform 3 GCTCCAAACTACTGTTACCGCT 141
ATAATCAGGTGTCTTGCGGGTG

Ranking of candidate reference genes using Norm-Finder.

Rank Tissue (Stability value)
  1 UDP (0.101)
  2 ECH1 (0.105)
  3 UBE2 (0.139)
  4 NTF2 (0.143)
  5 ARF1 (0.145)
  6 MPP (0.157)
  7 SKP1 (0.188)
  8 PP2A (0.223)
  9 EIF-4E1 (0.229)
10 PDI (0.244)
11 G6P (0.253)
12 GAPDH (0.272)
13 UBQ (0.276)
14 ACT1 (0.280)
15 PPS (0.309)
16 3-IPMDH (0.334)
17 β-tublin (0.348)
18 Tublin (0.391)
19 18srRNA (0.420)
20 CYP (0.546)
21 GAGA (0.591)

Ranking of candidate reference genes using BestKeeper.

Rank Tissues (CV%±SD)
  1 UBE2 (0.87±0.19)
  2 UDP (0.93±0.20)
  3 NTF2 (1.08±0.26)
  4 PDI (1.11±0.28)
  5 PP2A (1.61±0.39)
  6 SKP1 (1.65±0.38)
  7 ECH1 (1.72±0.42)
  8 MPP (1.85±0.48)
  9 G6P (1.92±0.47)
10 UBQ (1.95±0.46)
11 GAPDH (2.06±0.44)
12 β-tublin (2.24±0.52)
13 ACT1 (2.28±0.49)
14 3-IPMDH (2.44±0.59)
15 PPS (2.49±0.61)
16 ARF1 (2.53±0.62)
17 EIF-4EI (2.96±0.75)
18 CYP (2.97±0.68)
19 18s rRNA (3.00±0.54)
20 GAGA (3.46±0.94)
21 Tublin (3.91±0.88)

CV, coefficient of variation.

Comprehensive ranking order.

Ranking order Genorm Normfinder Bestkeeper Comprehensive ranking (mean)
  1 UDP UDP UBE2 UDP (1.67)
  2 NTF2 ECH1 UDP NTF2 (3.67)
  3 UBE2 UBE2 NTF2 UBE2 (3.83)
  4 SKP1 NTF2 PDI PDI (4.67)
  5 ECH1 ARF1 PP2A ECH1 (5.33)
  6 PDI MPP SKP1 SKP1 (5.57)
  7 MPP SKP1 ECH1 MPP (6.23)
  8 PP2A PP2A MPP PP2A (6.58)
  9 ARF1 EIF-4E1 G6P ARF1 (9.17)
10 UBQ PDI UBQ UBQ (10.31)
11 G6P G6P GAPDH G6P (10.99)
12 GAPDH GAPDH β-tublin GAPDH (11.65)
13 ACT1 UBQ ACT1 ACT1 (12.98)
14 EIF-4E1 ACT1 3-IPMDH EIF-4E1 (13.31)
15 3-IPMDH PPS PPS 3-IPMDH (14.98)
16 β-tublin 3-IPMDH ARF1 β-tublin (15.00)
17 PPS β-tublin EIF-4E1 PPS (15.67)
18 18s rRNA Tublin CYP 18s rRNA (18.67)
19 Tublin 18sr RNA 18sr RNA Tublin (19.33)
20 CYP CYP GAGA CYP (19.34)
21 GAGA GAGA Tublin GAGA (20.67)