The human Huh7 hepatocellular carcinoma cell line was purchased from the American Type Culture Collection (Manassas, VA, USA). Cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum (Hyclone; GE Healthcare, Logan, UT, USA) at 37°C in an atmosphere of 5% CO₂ with humidity. The culture medium was changed every 24 h. Cells were treated with 50 µM AG490 (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and incubated in a humidified chamber supplemented with 5% CO₂ at 37°C for 48 h.

Knockdown of human HOTAIR (Gene ID, 100124700) was achieved by transfection of small interfering RNA (siRNA). The siRNA sequences were as follows: HOTAIR, 5′- UAACAAGACCAGAGAGCUGUU −3′ and negative control (NC), 5′-TTCTCCGAACGTGTCACGT-3′. The sequences of siRNA were previously described (8,15) and were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China). Cells were seeded in 24-well culture dishes at a density of 10⁵ cells/well and incubated in a humidified chamber supplemented with 5% CO₂ at 37°C. siRNA (2 µM) transfection was performed using Lipofectamine™ 3000 (1 µM) (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) for 25 min at room temperature according to the manufacturer's protocol. After transfection, cells were incubated in a humidified chamber supplemented with 5% CO₂ at 37°C for 48 h. Mock-transfected cells were transfected with Lipofectamine™ 3000 without siRNA.

RT-qPCR was performed to determine the expression levels of lncRNA HOTAIR and the mRNA expression of CCND1. Briefly, 24 h after transfection, total RNA of the cells was harvested using RNAiso Plus reagent (Takara Biotechnology Co., Ltd., Dalian, China). Total RNA was reverse transcribed into cDNA using PrimeScript™ RT Reagent kit with gDNA Eraser (Takara Biotechnology Co., Ltd.). Thermocycling conditions were as follows: At 37°C for 15 min, at 85°C for 5 sec to inactivate the enzyme, and cooling at 37°C for 1 min. qPCR was performed on cDNA using SYBR^® Premix Ex Taq™ II (Takara Biotechnology Co., Ltd.). The reaction volume was 25 µl, containing SBYR Premix Ex Taq II (12.5 µl), 1 µl of each forward and reverse primer, cDNA (2 µl) and dH₂O (8.5 µl). Thermocycling conditions were as follows: Initial denaturation at 95°C for 5 min, followed by 40 cycles of denaturation at 95°C for 20 sec, annealing at 58°C for 30 sec and elongation at 72°C for 30 sec. The relative expression levels of CCND1 mRNA and lncRNA HOTAIR were calculated according to the comparative Cq method and normalized to GAPDH expression (16). The following primers were used in the present study: HOTAIR, forward 5′-CAGTGGGGAACTCTGACTCG-3′, reverse 5′-GTGCCTGGTGCTCTCTTACC-3′; CCND1, forward 5′-CCGCCTCACACGCTTCCTCTC-3′, reverse 5′-CGGCCTTGGGGTCCATGTTCT-3′; GAPDH, forward 5′-GCACCGTCAAGGCTGAGAAC-3′, reverse 5′-TGGTGAAGACGCCAGTGGA-3′.

After 48 h transfection, the cells were lysed with radioimmunoprecipitation assay lysis buffer (Cell Signaling Technology, Inc., Danvers, MA, USA) in the presence of protease/phosphatase inhibitor cocktail (Cell Signaling Technology, Inc.) at 4°C for 30 min, and the lysates were centrifuged at 12,000 × g at 4°C for 20 min. The concentration of protein was measured using a bicinchoninic acid protein assay kit (Thermo Fisher Scientific, Inc.). Equal amounts (30 µg) of extracted protein samples were separated by 10% SDS-PAGE and transferred onto polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA). After blocking with 5% non-fat milk for 2 h at room temperature, the membranes were incubated with the following primary antibodies at 4°C under gentle agitation overnight: Rabbit monoclonal cyclin D1 antibody (1:10,000; cat no. ab134175; Abcam, Cambridge, UK), rabbit polyclonal phosphorylated (p)-STAT3 (Tyr705) antibody (1:2,000; cat no. 9145; Cell Signaling Technology, Inc.), mouse monoclonal STAT3 antibody (1:1,000; cat no. 9139; Cell Signaling Technology, Inc.) and mouse monoclonal GAPDH antibody (1:1,000; cat no. sc-47724; Santa Cruz Biotechnology, Inc., Dallas, TX, USA). Subsequently, membranes were incubated with horseradish peroxidase-conjugated goat anti-rabbit (cat no. SA00001-2) or goat anti-mouse (cat no. SA00001-1) antibodies (1:5,000; ProteinTech Group, Inc., Chicago, IL, USA) for 2 h at room temperature under gentle agitation. Protein bands were visualized using the Supersignal^® West Pico Chemiluminescent substrate (Thermo Fisher Scientific, Inc.) on X-ray films. Blots were semi-quantified by densitometric analysis using ImageJ software version 1.51 (National Institutes of Health, Bethesda, MD, USA).

Cell proliferation assay was performed using a Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan) assay. Cells were seeded in 96-well plates (Corning Inc., Corning, NY, USA) at a density of 10⁴ cells/well and incubated in a humidified chamber supplemented with 5% CO₂ at 37°C. The CCK-8 assay was used to detect the viability of cells following the manufacturer's protocol. CCK-8 solution (10 µl) was added in each well and cells were incubated in a humidified chamber supplemented with 5% CO₂ at 37°C for 1 h. The absorbance was measured at a wavelength of 450 nm using a microplate reader. Six replicate wells were used for each group.

The cell cycle profile was analyzed using flow cytometry. Briefly, 1×10⁶ cells were harvested and fixed with ice-cold 75% ethanol at 4°C overnight and incubated with propidium iodide (PI; 50 µg/ml; Sigma-Aldrich, Merck KGaA) in the dark at room temperature for 30 min. Flow cytometric analysis was performed on a Beckman Coulter EPICS analyzer (Beckman Coulter, Inc., Brea, CA, USA). Multicycle AV software version 3.0 (Phoenix Flow Systems, San Diego, CA, USA) was employed for calculating the cell cycle phase distribution from the resultant DNA histogram.

Data are presented as mean ± standard deviation of 3 independent experiments. Statistical analysis was performed using using SPSS software version 13.0 (SPSS, Inc., Chicago, IL, USA). The statistical significance of the differences between groups was assessed using a two-tailed Student's t-test or one-way analysis of variance followed by a Tukey post hoc test. P<0.05 was considered to indicate a statistically significant difference.

In order to investigate the potential role of Hotair in HCC, specific siRNA targeting HOTAIR was used to transfect Huh7 hepatocarcima cells to silence HOTAIR expression. Transfection of Huh7 cells with HOTAIR siRNA resulted in significant knockdown of HOTAIR expression compared with the siNC group (P<0.05; Fig. 1A). NC siRNA had no significant impact on the expression level of HOTAIR compared with the Mock cells.

The role of Hotair on the prolferation of Huh7 cells, was examined by determining the effect of HOTAIR siRNA on cell growth. The proliferation of HOTAIR knockdown cells was significantly reduced compared with the siNC and Mock cells at 36, 48 and 72 h post-transfection (P<0.05; Fig. 1B).

To evaluate whether Hotair has a role in the regulation of cell cycle progression of Huh7 cells, the cell cycle phases of HOTAIR knockdown cells were analyzed. The present study determined that the cell cycle was primarily blocked at the G0/G1 checkpoint in the HOTAIR knock-down cells, compared with the NC and Mock cells. In the HOTAIR knockdown cells, the G0/G1 ratio was significantly higher and the proportion of cells in S + G2/M was significantly lower than the NC and Mock cells (P<0.05; Fig. 2).

To evaluate the role of Hotair on the proliferation and cell cycle of Huh7 cells, the expression level of a key regulator of the G1-S phase transition, CCND1, was measured. CCND1 expression was positively associated with HOTAIR expression in Huh7 cells. Compared with the siNC group, the mRNA expression levels of CCND1 (Fig. 3A) and its cyclin D1 protein product (Fig. 3B and C) were significantly reduced in HOTAIR knockdown cells (P<0.05).

As cyclin D1 has been demonstrated to be a downstream target of STAT3, the present study investigated whether Hotair regulated cyclin D1 expression via the STAT3 signaling pathway. Compared with the siNC group, the protein expression levels of cyclin D1 and phosphorylated (p) STAT3 were significantly reduced in HOTAIR knockdown cells (P<0.05; Fig. 4). However, the expression level of total STAT3 was not affected in the HOTAIR knockdown cells, compared with the siNC group.

To further explore the effect of Hotair and STAT3 signaling on cyclin D1 expression. Huh7 cells were treated with the STAT3 inhibitor, AG490, for 1 h prior to HOTAIR siRNA transfection. Cyclin D1 and pSTAT3 expression levels were suppressed following AG490 treatment in cells transfected with or without siHotair; however, the suppresion was greater in the cells treated with AG490 and HOTAIR siRNA in combination (P<0.05, Fig. 5). Overall, the data suggested that reduced HOTAIR expression was associated with reduced cyclin D1 expression and STAT3 phosphorylation. Knockdown of HOTAIR combined with STAT3 inhibition led to an additional decrease in cyclin D1 expression and STAT3 phosphorylation compared with individual treatments.