MOLT-4 adult ALL, Jurkat childhood ALL cell lines and H9 normal human T lymphocyte cell lines were purchased from American Type Culture Collection (Manassas, VA, USA) and cultured in RPMI-1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) that contained 1% penicillin-streptomycin and 10% fetal bovine serum (FBS; Gibco; Thermo Fisher Scientific, Inc.) at 37°C with 5% CO₂. Then ~4×10⁵ cells were transfected with pCMV-Tag 2B empty vector (Youbio, Hunan, China) FLAG-GATA4 (pCMV-Tag 2B-GATA4) or small interfering RNA (siRNA) against scrambled (SCR), GATA4 siRNA (siGATA4) or siGATA4 and sip21 simultaneously using Lipofectamine 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according the manufacturer's protocol. Following 48 h transfection, cells were collected by 800 × g centrifugation at 4°C for 5 min and used for the further experiments. siRNA sequences were as follows: siGATA4#1, AACCGGCCGCTCATCAAGCCT; siGATA4#2, AATCTCGTAGATATGTTTGAC; sip21, AACTTCGACTTTGTCACCGAG.

A total of 42 blood samples from patients with ALL and 42 samples from healthy controls were collected from patients at the First Hospital of Jilin University (Changchun, China) between 2010 and 2016. All patients had been informed about the nature of the experiments and provided written informed consent. The study was approved by the Ethics Committee of the First Hospital of Jilin University.

Cells (~4×10⁶) were lysed with radioimmunoprecipitation assay buffer (Beyotime Institute of Biotechnology, Haimen, China) containing a protease inhibitor cocktail (Beijing Transgen Biotech Co., Ltd., Beijing, China) at 4°C for 30 min. Protein concentrations were measured using the Bradford Reagent (Beyotime Institute of Biotechnology). A total of 40 µg protein was loaded in each well and resolved by 8% SDS-PAGE. Proteins were transferred to polyvinylidene fluoride membranes, which were subsequently blocked with 5% non-fat milk at 37°C for 1 h. The membranes were incubated with the following primary antibodies at 4°C overnight: anti-GATA4 (ab124265; 1:600) anti GADD45 (ab105060; 1:3,000), anti-p21 (ab109520; 1:2,000), anti-14-3-3σ (ab14123; 1:2,000) and anti-β-actin (1:1,000) from Abcam (Cambridge, MA, USA); and anti-FLAG (F1804 1:5,000), anti-MDM2 (SAB4300601; 1:2,000), anti-BCL2 (SAB4300340; 1:500) and anti-p53 (P9249; 1:1,000) from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany). Membranes were washed three times with TBS + 1% Tween-20 and incubated with horseradish peroxidase-conjugated secondary goat anti-mouse immunoglobulin (Ig)G (ab6728; 1:5,000; Abcam) or goat anti-rabbit IgG (ab6721; 1:5,000; Abcam) at room temperature for 1 h. Immunoreactive protein bands were visualized using the Enhanced Chemiluminescence kit (Beyotime Institute of Biotechnology). Each experiment was performed at least 3 times.

Total RNA was extracted from 3×10⁶ cells using the RNAprep Pure kit (Tiangen Biotech Co., Ltd., Beijing, China), following the manufacturer's protocol. Total RNA (2 µg) was reverse transcribed into cDNA using the FastKing RT kit (Tiangen Biotech Co., Ltd.), according to the manufacturer's protocol. qPCR was performed with the RealMaster mix SYBR-Green (Tiangen Biotech Co., Ltd.) and an ABI PRISM 7700 Real Time Thermal Cycler (Applied Biosystems; Thermo Fisher Scientific, Inc.). The RT-qPCR conditions were as follows: 5 min at 95°C, denaturation at 95°C for 30 sec, annealing at 57°C for 30 sec and extension at 72°C for 60 sec, performed for 34 cycles. The primers were as follows: GATA4, 5′-CCCAATCTCGTAGATATGTTTGAC-3′ and 5′-CCGTTCATCTTGTGGTAGAG-3′; BCL2, 5′-GCTATAACTGGAGAGTGCTG-3′ and 5′-ACTTGATTCTGGTGTTTCCC-3′; MDM2, 5′-TCAAACTCCTGACCTCAAGTG-3′ and 5′-TTACCATCATAAGCCTACAGACC-3′; p53, 5′-GACCTATGGAAACTACTTCCTG-3′ and 5′-CATTCTGGGAGCTTCATCTG-3′; p21, GCATGACAGATTTCTACCAC-3′ and 5′-GACTAAGGCAGAAGATGTAGAG; GADD45, 5′-CGAGAACGACATCAACATCC-3′ and 5′-ATGAATGTGGATTCGTCACC-3′; 14–3-3σ, 5′-AGACAACCTAACACTTTGGAC-3′ and 5′-AGGAAAGAAGGATGACACCC-3′; GAPDH, 5′-CATTTCCTGGTATGACAACGA-3′ and 5′-TACATGGCAACTGTGAGGAG-3′. Relative mRNA expression levels of indicated genes were calculated by the 2^−ΔΔCq method (22). GAPDH was used as internal control and for normalization. Each experiment was performed at least 3 times.

Following 48 h transfection, cells (4×10³ cells/well in 100 µl RPMI-1640 medium) were cultured in 96-well plates at 37°C. CCK-8 solution (10 µl; Beyotime Institute of Biotechnology) was added to each well and incubated at 37°C for 3 h. A microplate reader was used to measure the absorbance at 450 nm; the absorbance indicated cells proliferation. Each experiment was performed at least 3 times.

Adriamycin was purchased from Selleck Chemicals (Houston, TX, USA) and dissolved in phosphate-buffered saline (PBS). Following 48 h transfection, Adriamycin (5 µg/ml) was added to the culture medium and incubated for 24 h at 37°C to induce apoptosis. Subsequently, apoptotic rates were examined with the Annexin V/fluorescein isothiocyanate (FITC) Apoptosis Detection kit (Abcam), according to the manufacturer's protocol. Briefly, approximately 4×10⁵ cells were collected by 800 × g centrifugation at 4°C for 5 min, washed with PBS and stained with Annexin V and propidium iodide. Attune™ NxT Software (version 1.0; Thermo Fisher Scientific, Inc.) was used to analyze apoptotic cells using a flow cytometer. Each experiment was performed at least 3 times.

Costar Transwell chambers (Corning Inc., Corning, NY, USA) were used to detect the cell migration and invasion ability. Uncoated Transwell inserts were used to assess cell migration ability, whereas Transwell inserts precoated with Matrigel (BD Biosciences, San Jose, CA, USA) were used to determine cell invasion ability. Jurkat cells were transfected for 48 h, resuspended in RPMI-1640 without FBS, and plated (2×10⁴ cells) into the upper chamber; the lower chamber was filled with 500 µl RPMI-1640 supplemented with 10% FBS. Cells were incubated at 37°C with 5% CO₂ in a humidified air atmosphere for 24 h. Following incubation, cells in the upper chamber were removed with cotton swabs, and cells in the lower chamber were fixed with 4% paraformaldehyde and stained with 0.5% crystal violet. Stained cells were counted (6 fields were counted for each membrane) under a light microscope. Each experiment was performed at least 3 times.

ChIP analysis was performed with the Chromatin Immunoprecipitation Assay kit (Beyotime Institute of Biotechnology), according to manufacturer's protocol. Briefly, cells were grown to 85–95% confluence, washed cells three times with PBS and chemically cross-linked with 1% formaldehyde for 20–30 min at 37°C. Subsequently, cells were lysed with lysis buffer at 4°C for 30 min and sonicated 3 cycles at 4°C, each cycle of 15 times. Following lysis, 3 µg GATA4 antibody was added to the lysis solution and incubated at 4°C overnight. Anti-rabbit IgG was used as control. Protein A beads were used to isolate antibody-interacted DNA fragments. The binding chromatin was purified by Qiagen PCR Purification kit (Qiagen China Co., Ltd., Shanghai, China). Chromatin fragments was analyzed by PCR and detected by gel electrophoresis. The PCR assay was performed using 2XEasyTaq PCR SuperMix (Transgene, Beijing, China) according to manuscript's protocol. The PCR conditions were as follows: 5 min at 95°C, denaturation at 95°C for 30 sec, annealing at 56°C for 30 sec and extension at 72°C for 30 sec, performed for 32 cycles. The primers were as follows: BCL2, 5-GGACTTCTGCGAATACCG-3′ and 5-GTCCCTGAGGGCTTCATT-3′; MDM2, 5-CGGGTTCACAGGATTGTC-3′ and 5-GATGCTGGTTACCGTTGG-3′. Each experiment was performed at least 3 times.

Cells (3×10⁵) were transfected with vector, GATA4 or SCR, siGATA4, when the density of cells was almost 90–100%, cells were scratched with a 20 µl pipette and photographed at 0 h or 48 h under a light microscope. The distance of cells migration indicated the migration ability of cells. Each experiment was performed at least 3 times.

The promoter sequence of MDM2 or BCL2 was cloned into a pGL3 firefly luciferase reporter plasmid vector. Jurkat cells (3×10⁶) were co-transfected with 0.2, 0.5, 1 and 2 µg FLAG-GATA4, Renilla and pGL3-MDM2-promoter or pGL3-BCL2-promoter using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). The Renilla luciferase plasmid vector was used as an internal control. Following 24 h transfection at 37°C, firefly and Renilla luciferase activities were measured through the Dual-Luciferase Reporter Assay system (Promega Corporation, Madison, WI, USA). Firefly luciferase activity was normalized to Renilla luciferase activity. Each experiment was performed at least 3 times.

All data were expressed as the mean ± standard deviation; and each experiment was performed at least three times. The data were analyzed by SSPS 19.0 (IBM Corp., Armonk, NY, USA). Comparisons between groups were made by one-way analysis of variance followed by Tukey's test, and comparisons between two groups were made with Student's t-test. P<0.05 was considered to indicate a statistically significant difference.

To determine the expression of GATA4 in childhood ALL, blood samples from 42 patients with ALL and 42 healthy controls were collected. RT-qPCR was used to assess GATA4 mRNA expression (Fig. 1A). Compared with healthy control group, the expression of GATA4 mRNA was significantly higher in the childhood ALL samples. In addition, GATA4 mRNA and protein expression was examined in Jurkat and MOLT-4 ALL cell lines, using the H9 normal human T lymphocyte cell lines as a control. The results indicated that the mRNA and protein levels of GATA4 expression were upregulated in ALL cell lines compared with H9 (Fig. 1B and C, respectively).

To further analyze the function of GATA4 in ALL, GATA4 was either overexpressed or silenced in Jurkat and MOLT-4 cell lines, and subsequent mRNA and protein expression levels were determined by RT-qPCR and western blotting, respectively. The results indicated that the expression of GATA4 was upregulated in FLAG-GATA4-transfected cells, but downregulated in siGATA4-transfected cells (Fig. 2A and B); transfection with siGATA4#2 appeared to be more efficient compared with siGATA4#1, therefore siGATA4#2 was used for the further experiments.

To elucidate the function of GATA4 on the progression of ALL, CCK-8 cell viability analysis was conducted. As shown in Fig. 2C, the proliferation of Jurkat cells that ectopically expressed GATA4 was significantly increased compared with the Vector control group. Conversely, siGATA4 knockdown of GATA4 expression significantly suppressed cell proliferation compared with expression in the SCR control (Fig. 2C); similar results were observed in MOLT-4 cells (Fig. 2C). To determine the mechanism of GATA4 in proliferation, the role of GATA4 in apoptosis was examined using flow cytometry. Compared with the control groups, the rate of apoptosis was decreased in the cells that overexpressed GATA4; however, the apoptotic rate was increased in the cells transfected with siGATA4 (Fig. 2D). In addition, cell cycle analysis revealed that overexpression of GATA4 promoted G₁/S phase transition; however, inhibition of GATA4 arrested cell cycle at G₀/G₁ phase (Fig. 2E). These results suggested that GATA4 may facilitate cell proliferation by inhibiting cell apoptosis and promoting cell G₁/S phase transition.

To further investigate the roles of GATA4 on ALL progression, Transwell analysis was performed to explore the migratory and invasive abilities of ALL cells under different experimental conditions. The number of migrating cells in the GATA overexpression group was as significantly higher compared with the Vector control group (Fig. 3A). By contrast the number of migrating cells in the siGATA4 was significantly decreased compared with the SCR control group (Fig. 3A). Invasion analysis results revealed similar results (Fig. 3B). Results from the wound-healing assay confirmed that GATA4 expression promoted cell migration: Overexpression of GATA4 significantly increased cell migration distance following 48 h culture; however, knockdown of GATA4 expression lead to a decreased in cell migration distance (Fig. 3C). These data suggested that GATA4 may serve a role in promoting cell migration and invasion.

GATA4 has been previously reported to regulate the apoptotic process by regulating the transcription of BCL2 in embryonic stem cells or ovarian follicles (14,15,23,24). However, whether GATA4 mediated apoptosis in this manner in ALL was unknown. To explore the mechanism of GATA4 on apoptosis in ALL, the expression of BCL2 protein and mRNA in cells in which GATA4 is overexpressed or silenced was examined. The results revealed that both the protein and mRNA levels of expression of BCL2 were notably increased in GATA4-overexpression cells (Fig. 4A and B, respectively). Cell apoptosis was also previously demonstrated to be regulated by the p53-MDM2 pathway (25); therefore, the expression of p53 and MDM2 was examined in GATA4-overexpressing Jurkat cells. The expression level of MDM2 protein was increased, whereas the expression of p53 protein was decreased in cells that ectopically expressed GATA4 (Fig. 4A). Similarly, the mRNA expression level of MDM2 was significantly increased and the mRNA expression level of p53 was slightly decreased in cells overexpressing GATA4 (Fig. 4 and B). The results suggested that GATA4 may regulate apoptosis in ALL through BCL2 and the p53-MDM2 pathway.

As GATA4 is a zinc-finger-containing transcription factor, the present study hypothesized that GATA4 activated the transcription of BCL2 and MDM2. To verify this hypothesis, ChIP analysis was performed with anti-GATA4 in Jurkat cells (Fig. 4C). The results suggested that GATA4 interacted with the promoter region of BCL2 and MDM2 in Jurkat cells. In addition, results from the dual-luciferase reporter assay demonstrated that GATA4 activated the transcription of BCL2 and MDM2 (Fig. 4D). These results demonstrated that GATA4 may target the promoter of BCL2 and MDM2 to change the expression levels of BCL2 and MDM2.

It was found that GATA4 negatively regulated p53 through transcriptional activating MDM2. The p53 pathway has been found to regulate cell cycle through transcriptional activating of p21, GADD45 and 14–3-3σ. p21 interacted with Cyclin-CDK complex and inhibited it phosphorylating Rb and resulted in cells arresting at G₁ phase. To investigate the mechanism of GATA4 facilitation of G₁/S phase transition, the expression of p21, GADD45 and 14-3-3σ were examined in Jurkat cells in which GATA4 was overexpressed or silenced (Fig. 5A and B, respectively). Consistent with our hypothesis, the expression of p21 was decreased in GATA4-overexpressing cells, whereas no notable changes in the protein expression levels of GADD45 and 14-3-3σ were observed (Fig. 5A). However, knockdown of GATA4 increased the expression of p21 (Fig. 5B). Next, GATA4 and p21 were knocked down together, and the cell cycle determined. It was found that when GATA4 and p21 were silenced together, the percentage of cells at S was increased compared with the group which only silenced GATA4; similar results were observed in MOLT-4 cells (Fig. 5C). Together, GATA4 facilitated G₁/S transition through p53-p21 pathway.