Gene constructs
The cDNA encodings of HCA587/MAGEC2 and TAF9 were generated by reverse-transcription polymerase chain reaction (RT-PCR) using cDNA from A375 human malignant melanoma cells (ATCC, Manassas, VA, USA) as templates. Total RNA was isolated using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA), and first strand cDNA was generated using the Reverse Transcription kit (Promega Corporation, Madison, WI, USA). Primer sequences were forward, 5′-GCGTCGACGCCACCATGCCTCCCGTTCCAGGCGTT-3′ and reverse, 5′-GAATGCGGCCGCTCACTCAGAAAAGGAGACforHCA587/MAGEC2; forward, 5′-GCGTCGACAATGGAGTCTGGCAAGACGGCT-3′ and reverse, 5′-ATAAGAATGCGGCCGCTTACAGATTATCATAGTCAT-3′ for TAF9. The PCR conditions for both HCA587/MAGEC2 and TAF9 were 95°C for 5 min, followed by 35 cycles at 95°C for 30 sec, 58°C for 30 sec and 72°C for 90 sec. The aforementioned cDNA was subcloned into expression vectors pRK-FLAG and/or pRK-hemagglutinin (HA) (provided by Professor Jun Zhang, Peking University), and the constructed plasmids were transfected into mammalian cells using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) for expression of HCA587/MAGEC2 and TAF9 respectively. cDNA encoding TAF9 (residues 1–73), TAF9 (residues 74–147), TAF9 (residues 148–278) were generated by PCR (M3001; Promega Corporation) using TAF9 full-length cDNA plasmids as templates. Primer sequences were forward, 5′-GCGTCGACAGAGTCTGGCAAGACGGCTTCT-3′ and reverse, 5′-ATAAGAATGCGGCCGCTCATGCCAATCGCACATCATCT-3′ for TAF9 (residues 1–73); forward, 5′-GCGTCGACAATCCAGTGCCGCGCTGATCA-3′ and reverse, ATAAGAATGCGGCCGCTCACCGCGGGACTGTTATTC for TAF9 (residues 74–147); forward, 5′-GCGTCGACATTAAGTGTTGGTTCAGTTAC-3′ and reverse, 5′-ATAAGAATGCGGCCGCTTACAGATTATCATAGTCAT-3′ for TAF9 (residues 148–278). The PCR conditions for all the fragments were 95°C for 5 min, followed by 35 cycles at 95°C for 30 sec, 60°C for 30 sec and 72°C for 30 sec. For the glutathione S-transferase (GST)-fusion protein expression, cDNAs encoding full-length and truncated TAF9 were ligated into PGEX-4T vector (GE Healthcare, Chicago, IL, USA).
Co-immunoprecipitation and western blotting
293T cells (ATCC) were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (Invitrogen; Thermo Fisher Scientific, Inc.). The expression vectors pRK-FLAG-HCA587 and/or pRK-HA-TAF9 (1 µg/ml respectively) were co-transfected into 293T cells, using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). The cells were harvested 48 h following transfection, washed with PBS, lysed with IP-buffer (20 mM Tris-HCl, 150 mM NaCl, 1% TritonX-100 and 1 mM EDTA) supplemented with a protease inhibitors cocktail (Roche Diagnostics, Indianapolis, IN, USA), and the protein concentration of the cell extract was determined by BCA protein assay. Lysates were cleared by centrifugation at 16,000 × g for 10 min at 4°C, pre-cleared with empty beads and subjected to immunoprecipitation with mouse monoclonal anti-HA antibody (M180-3; 1:2,000; MBL, Nagoya, Japan), mouse monoclonal anti-FLAG antibody (F1804; 1:5,000; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) or an equal amount of normal mouse immunoglobulin (Ig)G (I5381; Sigma-Aldrich; Merck KGaA) at 4°C overnight, followed by adding protein A-Sepharose (GE Healthcare) for additional 4 h. For endogenous co-immunoprecipitation, A375 cells were lysed with IP-buffer and protein concentration was determined as described above, and subjected to immunoprecipitation with rabbit polyclonal anti-HCA587 antibody (TC-1; 1:200; 2 mg/ml prepared by our laboratory) (25) or normal rabbit IgG (I5006; 1:200; 2 mg/ml; Sigma-Aldrich; Merck KGaA). The immunoprecipitates were subsequently washed with IP-buffer for 1 h at 4°C. Complexes were released from the protein-A-sepharose by boiling for 5 min in 2X SDS loading buffer, subjected to 10% SDS-PAGE (50 µl sample/lane), transferred to NC membranes, blocked with PBS-5% skimmed milk at room temperature for 1 h, and detected using anti-HA (M180-3; 1:2,000), anti-FLAG (F1804; 1:5,000), anti-HCA587 (McAb, LX-CT10.5; 1:1,000; provided by Professor Boquan Jin, Fourth Military Medical University) (26), or anti-TAF9 (ab169784; 1:1,000; Abcam, Cambridge, MA, USA) antibodies, followed by adding anti-mouse (W4021; 1:8,000; Promega Corporation) or anti-rabbit (W4011; 1:10,000; Promega Corporation) antibodies conjugated to horseradish peroxidase. Immunoreactive bands were analyzed with an enhanced chemiluminescence kit (BF06053; Beijing Biodragon Immunotechnologies Co., Ltd., Beijing, China.)
Immunofluorescence
A375 cells were grown directly on glass coverslips for 24 h and then fixed with 3.7% formaldehyde in PBS for 5 min at room temperature, and further permeabilized by 100% methanol for 5 min at −20°C. Following 1 h blocking in PBS-5% skimmed milk at room temperature, cells were incubated overnight with the following antibodies: Anti-HCA587/MAGEC2 mouse IgG (LX-CT10.5; 1:500), anti-TAF9 rabbit IgG (sc98825; 1:100; Santa Cruz Biotechnology, Inc.), normal mouse IgG or normal rabbit IgG (equal amount of antibodies) were used as negative controls. Following washing with PBS, cells were incubated for 1 h at room temperature with FITC-conjugated anti-rabbit IgG or rhodamine-conjugated anti-mouse IgG (ZF0311 and ZF0313 respectively; 1:200; OriGene Technologies, Inc., Beijing, China). Hoechst 33342 (Sigma-Aldrich; Merck KGaA) staining was performed for 5 min at room temperature to visualize the cell nucleus. Images were captured and analyzed using a confocal microscope.
GST pull-down assay
Recombinant human HCA587/MAGEC2 protein was prepared by Crown Bioscience, Inc., (Beijing, China) (27). GST-TAF9 (full-length), TAF9 (residues 1–73), TAF9 (residues 74–147) and TAF9 (residues 148–278) were expressed in bacterial host BL21(DE3) by induction with 1 mM isopropyl-L-thio-β-D-galactopyranoside (Sigma-Aldrich; Merck KGaA), and were purified with glutathione Sepharose 4B beads (GE Healthcare) according to the instructions of the manufacturer. A total of 10 µg glutathione Sepharose-linked GST or GST-fusion protein was incubated with the HCA587/MAGEC2 protein in 200 µl GST binding buffer (PBS, 0.1% NP-40, 5 mM dithiothreitol and protease inhibitors cocktail) with rotation overnight at 4°C. The beads were then washed for 1 h at 4°C and bound proteins were separated by 10% SDS-PAGE (30 µl sample/lane), transferred to NC membranes, blocked with PBS-5% skimmed milk at room temperature for 1 h, and detected with anti-HCA587 (LX-CT10.5; 1:1,000), anti-GST (1:2,000; 10000–0-AP; ProteinTech Group, Inc., Chicago, IL, USA), or anti-TAF9 (sc98825; 1:1,000; Santa Cruz Biotechnology, Inc.) antibodies, followed by adding anti-mouse or anti-rabbit antibodies conjugated to horseradish peroxidase (W4021 and W4011; Promega Corporation) at room temperature for 1 h. Immunoreactive bands were analyzed with enhanced chemiluminescence kit as described above.