Recombinant human ATX (also known as Ectonucleotide Pyrophosphatase/Phosphodiesterase-2) was purchased from R&D Systems, Inc., Minneapolis, MN, USA. 1-Oleoyl lysophosphatidic acid sodium salt was from Tocris Bioscience (Bristol, UK). 17-β estradiol (estrogen) was from Sigma-Aldrich; Merck KGaA (Darmstadt, Germany). PD98059 [the phosphorylated extracellular signal-regulated kinase (p-ERK) inhibitor] was from Invitrogen (Thermo Fisher Scientific, Inc., Waltham, MA, USA). ATX antibody for western blotting was from Abcam (Cambridge, UK; ab77104) and for immunohistochemistry from Santa Cruz Biotechnology (Texas, USA; sc-374222). Antibodies against LPA receptors (LPA1, LPA2, LPA3) were from Abcam (ab166903, ab38322 and ab219267, respectively). Total/phosphorylated extracellular signal-regulated kinases (t/p-ERK) were from Cell Signaling Technology, Inc. Danvers, MA, USA (4695s and 4370s). Antibodies against GAPDH were from Santa Cruz Biotechnology (sc-51907). Crystal violet staining solution was from Tiangen Biotech Co., Ltd. (Beijing, China). Cell Counting kit (CCK)-8 was from Beyotime Institute of Biotechnology, Haimen, China (C0037). Transwell culture plates were from Corning Incorporated (Corning, NY, USA). Lipofectamine 2000™ transfection reagent was from Invitrogen, Thermo Fisher Scientific, Inc.

Ishikawa and Hec-1A cells are endometrial adenocarcinoma cell lines. Ishikawa cells were kindly provided by Dr Jonathan Braun (David Geffen School of Medicine, University of California, CA, USA) and kept and subcultivated in our laboratory; they are positive for estrogen receptor (ER). Ishikawa cells were cultured in F12-Dulbecco's modified Eagle's medium (M&C Gene Technology, Ltd., Beijing, China) supplemented with 10% fetal bovine serum (FBS; HyClone; GE Healthcare, Chicago, IL, USA) at 37°C with 5% CO₂ in a humidified atmosphere. The Hec-1A cell line was from American Type Culture Collection (ATCC; Manassas, VA, USA). Hec-1A cells with low ER expression were cultured in McCoy's 5A medium (M&C Gene Technology, Ltd.), as recommended by ATCC. Non-specific short interfering (si)RNA (si-NC) and two siRNA sequences specific to ATX were synthesized by Shanghai GenePharma Co., Ltd. (Shanghai, China; negative control: Sense: 5′-UUCUCCGAACGUGUCACGUTT-3′, Antisense: 5′-ACGUGACACGUUCGGAGAATT-3′; ATX-siRNA1: Sense: 5′-AUCGACAAAAUUGUGGGGCTT-3′, Antisense: 5′-GCCCCACAAUUUUGUCGAUTT-3′; ATX-siRNA2: Sense: 5′-CGUCAUCUUUGUCGGAGACTT-3′, Antisense: 5′-GUCUCCGACAAAGAUGACGTT-3′). Ishikawa and Hec-1A cells were grown until 60–70% confluent, and transfected with ATX siRNAs or siRNA-NC as a negative control at 100 nm by using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.). The serum-free medium (DMEM-F12 without FBS) with transfected siRNA was replaced with culture medium (DMEM-F12 with 10% FBS) following 6 h incubation. The transfected cells continued to be cultured until 48 h at 37°C in a 5% CO₂ incubator.

Total RNA was isolated from the transfected cells with ATX siRNAs or siRNA-NC by using TRIzol (Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Reverse transcription and cDNA synthesis involved the use of oligo-dT primers with 2 µg total RNA and Superscript III reverse transcriptase according to the First Strand cDNA Synthesis kit (cat no. KR108; Tiangen Biotech Co., Ltd.). PCR involved use of 5% total cDNA and was amplified with primers (ATX forward primer: 5′-CTTTCGGCCCTGAGGAGAGTA-3′, ATX reverse primer: AGCAACTGGTCTTTCCTGTCT; LPA1 forward primer: 5′-AATCGGGATACCATGATGAGTCTT-3′, LPA1 reverse primer: 5′-CCAGGAGTCCAGCAGATGATAAA-3′; LPA2 forward primer: 5′-CGCTCAGCCTGGTCAAGACT-3′, LPA2 reverse primer: 5′-TTGCAGGACTCACAGCCTAAAC-3′; LPA3 forward primer: 5′-AGGACACCCATGAAGCTAATGAA-3′, LPA3 reverse primer: 5′-GCCGTCGAGGAGCAGAAC-3′; GAPDH forward primer: CCTCCGGGAAACTGTGGCGTGATGG; GAPDH reverse primer: AGACGGCAGGTCAGGTCCACCACTG), using the FastFire qPCR PreMix (SYBR Green; cat no. FP207; Tiangen Biotech Co., Ltd.) with the thermocycling conditions of 95°C for 5 sec, 56°C for 10 sec and 72°C for 15 sec for 40 cycles with the iCycleriQ real-time PCR detection system (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Melting curve analysis was performed for each sample to ensure that a single product was produced in each reaction. The 2^−∆∆Cq method was used for quantification (10).

The tissues of 10 endometrial carcinoma patients were obtained previously from the Pathology Department of Peking University People's Hospital (Beijing, China). The pathological sections were already processed and paraffin embedded routinely following surgery.

The present study was approved by the ethics committee of Peking University People's Hospital (approval no. 2016PHB054-01). Slides of cancer samples continuous with surrounding endometrial tissue were determined by a pathologist in Pathology Department of Peking University People's Hospital. First, slides were dewaxed in xylene twice. After that, different concentrations of alcohol (95, 85 and 75%) were used to continue dewaxing and slides were then placed in water. Subsequently, peroxide enzyme was removed by adding 30% H₂O₂ to the slides, which were then washed three times with 1XPBS. Sections were then incubated with sealing fluid (ZLI-9022; OriGene Technologies, Inc., Beijing, China) for 30 mins, and then the following primary antibodies: Mouse anti-ATX (sc-374222; Santa Cruz Biotechnology), rabbit anti-LPA1, 2 and 3(ab166903, ab38322 and ab219267; Abcam) (dilution 1:400) and 1× PBS (negative control) at 4°C for 12 h. Sections were then probed with the mouse and rabbit secondary antibodies (PV-6001 and PV-6002; OriGene Technologies, Inc.) for 1 h at room temperature, followed by 3,3′diaminobenzidine color solution (ZLI-9018; OriGene Technologies, Inc.) for 20 sec each section at room temperature. The immunohistochemical results were analyzed using Image-Pro Plus software version 6.0 (Media Cybernetics, Inc., Rockville, MD, USA). From 5 randomly selected fields of each section (×400) images were captured using a light microscope (Eclipse 501; Nikon Corporation, Tokyo, Japan), the mean density (IOD SUM/area) and integrated optical density (IOD) value of positive stained areas were calculated and thence each sample's mean density. ATX, LPA1, LPA2 and LPA3 protein expression of 10 endometrial cancers and 10 non-carcinoma tissues samples were compared by t-test analysis.

The cells (2×10⁶ from each well in 6-wells plates) were harvested, washed three times with 1XPBS, and lysed in lysis buffer (R0020; Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) for 30 min on ice. The lysates were centrifuged (15 min at 12,000 × g, 4°C), and the protein concentration was determined by a bicinchoninic acid protein assay kit (23225; Thermo Fisher Scientific, Inc.). A total of 20–60 µg protein in each sample was separated by 10% SDS-PAGE and transferred onto nitrocellulose filter membranes (Merck KGaA). Membranes for target protein (ATX, LPA1, LPA2, LPA3 and GAPDH) were blocked with 5% skimmed milk for 1 h at room temperature. Membranes for interest protein (T-ERK and P-ERK) were blocked with 5% bovine serum albumin (BSA; B2064-50G; Sigma-Aldrich; Merck KGaA) for 1 h at room temperature. These membranes were separately incubated with primary antibodies ATX (ab77104; 1:1,000; Abcam), LPA1 (ab166903; 1:1,000, Abcam), LPA2 (ab38322; 1:1,000; Abcam), LPA3 (ab219267; 1:1,000; Abcam), T-ERK (4695s; 1:1,000; Cell Signaling Technology, Inc.), P-ERK (4370s; 1:1,000; Cell Signaling Technology, Inc.) and GAPDH (sc-51907; 1:5,000; Santa Cruz Biotechnology), with the 5% skimmed milk or BSA dilutions recommended by the manufacturer, at 4°C overnight. Membranes were then washed using 1XTBST with 0.1% Tween-20 and incubated with 1:3,000 secondary goat anti-rabbit IgG (ZB-2301; OriGene Technologies, Inc.) or goat anti-mouse IgG antibodies (ZB-2305; OriGene Technologies, Inc.). The membrane was incubated with luminol reagent and enhanced chemiluminescence (Lot No. 1614602, EMD Millipore, Billerica, MA, USA) for 30–120 sec at room temperature. The optical density of bands was quantified by using ImageJ software (v2.1.4.7; National Institutes of Health, Bethesda, MD, USA).

Ishikawa cells grown until 60–70% confluent were transfected with siRNA-NC or ATX siRNA and cultured for 24 h at 37°C with 5% CO₂ in a humidified atmosphere, then cells were seeded in 96-well culture plates at 2,000 cells per well. The absorbance values of almost immediately adherent cells 4 h after seeding were measured as the control group. Cells were incubated with CCK8 (C0037; 1:100; Beyotime Institute of Biotechnology) for 2 h at 37°C. Absorbance was measured at a wavelength of 450 nm using a microplate reader. Next, cell absorbance values were detected using CCK8 methods at days 1, 2, 3, and 4, respectively. Alternatively, cells were transfected with ATX siRNA and cultured for 24 h at 37°C, then seeded in 96-well culture plates at 2,000 cells per well and treated with 10 nM 17β-estradiol or 40 µM LPA for 48 h at 37°C. Cells were collected, incubated with CCK8 and the absorbance was measured as described above. In addition, cells were treated with 100 µM PD98059 (the p-ERK inhibitor) for 24 h at 37°C, then seeded in 96-well culture plates at 2,000 cells per well and treated with 10 nM 17β-estradiol or 40 µM LPA/0.5 nM ATX for 48 h at 37°C. Cells were then collected, incubated with CCK8 and the absorbance was measured as described above.

Ishikawa cells grown until 60–70% confluent were transfected with siRNA and cultured for 24 h at 37°C, rinsed with PBS twice, then digested with 0.25% trypsin solution for 2 min at 37°C. The neutralization reaction was induced by adding DMEM-F12 with 10% FBS and cells were centrifuged for 5 min at 300 × g at room temperature, liquid-decanted and 1 ml fresh culture medium was added. Cells were dispersed by pipetting repeatedly to create a single-cell suspension with culture medium. Subsequently, cells were counted using a cell counting chamber. A total of 500 cells were added to each well of 6-well culture plates for ~6 days and the medium was replaced every 3 days until cell clones were observed with the naked eye. Cells were washed with PBS twice and fixed in 4% paraformaldehyde for 15 min at room temperature. Cells were then stained with crystal violet for 5 min at room temperature, dried, images captured using an inverted microscope and counted using ImageJ software (version 2.1.4.7; National Institutes of Health).

Data are expressed as the mean ± standard error. All experiments were repeated 3 times. Quantitative results were compared using GraphPad Prism version 5.0 software (GraphPad Software, Inc., La Jolla, CA, USA). A two-tailed Student's paired t-test was used to test for significance between two groups. Multiple groups were compared by a one-way or two-way analysis of variance with Tukey's post-test correction. P<0.05 was considered to indicate a statistically significant difference.

Pathological sections of normal adjacent tissues and carcinoma tissues were obtained from 10 endometrial adenocarcinoma patients. Following immunohistochemistry, 5 randomly selected fields of stained pathological sections were photographed under a light microscope at ×400 magnification. The absorbance value of positive regions was analyzed using the Image-Pro Plus software version 6.0 (Media Cybernetics, Inc.). ATX expression was stronger in endometrial carcinoma than in adjacent non-cancerous tissue (Fig. 1A and C). Also, ATX was expressed in the cytoplasm of cancer cells and stromal cells. LPA1, 2, 3 expression levels were greater in endometrial cancer tissues than in adjacent non-cancerous tissue (Fig. 1B and C).

Ishikawa cells positive for ER and Hec-1A cells with low ER expression exhibited ATX expression (Fig. 2A). However, ATX mRNA expression was higher in Ishikawa cells than in Hec-1A cells (Fig. 2A). ATX was primarily expressed in the cytoplasm of the cells by immunocytochemistry (Fig. 2B). ATX protein expression was also greater in Ishikawa cells than in Hec-1A cells (Fig. 2C and D). The mRNA expression levels of LPA1, 2 and 3 were detected in both cell types, and LPA2 expression was the greatest (Fig. 2E and F).

To understand the role of ATX in endometrial adenocarcinoma, 2 siRNA sequences were used to obtain loss of function of ATX in Ishikawa cells. The mRNA and protein expression levels of ATX were significantly decreased following siRNA knockdown of ATX compared with Ishikawa cells transfected with siRNA-NC (Fig. 3A and B). The CCK8 assay revealed that the rate of cell growth was slower in cells transfected with ATX siRNA than in Ishikawa cells transfected with siRNA-NC (Fig. 3C). In addition, Ishikawa cells exhibited lower colony numbers following ATX knockdown (Fig. 3D).

ATX expression was significantly increased in Ishikawa cells positive for ER. It was then determined whether estrogen induced the expression of ATX by examining the mRNA expression of ATX in Ishikawa cells treated with 17β-estradiol for 24 h. The mRNA expression of ATX was significantly induced by estrogen compared with the control (Fig. 4A). It was subsequently determined whether ATX was involved in estrogen- and LPA-induced cell proliferation. Inhibition of ATX with siRNA decreased the cell proliferation induced by estrogen, LPA or estrogen in combination with LPA (Fig. 4B-D).

To confirm the effect of ATX on LPA receptors, Ishikawa cells were transfected with ATX siRNA, and then the mRNA expression levels of LPA1, 2 and 3 were determined. To varying degrees, the expression of LPA 1, 2 and 3 receptors was reduced following ATX siRNA treatment when compared with the siRNA-NC group, and LPA2 expression was the most significantly reduced (Fig. 5A). Ishikawa cells were subsequently treated with different concentrations of LPA. LPA at 80, 40 and 20 µM significantly increased the phosphorylation of ERK compared with 0 µM (Fig. 5B). p-ERK expression levels were downregulated following siRNA knockdown of ATX compared with the siRNA-NC group (Fig. 5C). Transfection with ATX siRNA reduced LPA or estrogen-induced ERK phosphorylation (Fig. 5D and E). In addition, inhibition of the ERK signaling pathway by PD98059 with estrogen and/or ATX and LPA treatment decreased cell proliferation (Fig. 5F and G).