Chrysophanol (cat no. 01542) and Paclitaxel (cat no. 1491332) were purchased from Sigma-Aldrich (St. Louis, MO, USA). NF-κB inhibitor (BAY 11–7082; cat no. S1523) was purchased from Beyotime Institute of Biotechnology (Shanghai, China).

Breast cancer cell line MCF-7 and MDA-MB-231 were purchased from the American Type Culture Collection (Manassas, VA, USA) and cultured in RPMI-1640 (Invitrogen; Thermo Fisher Scientific, Carlsbad, CA, USA) with 10% FBS (Invitrogen; Thermo Fisher Scientific) and 0.01 mg/ml human recombinant insulin (cat no. I3536; Sigma-Aldrich). The cultures were maintained at 37°C in a humidified incubator containing 5% (v/v) CO₂ in air. Cells were seeded at a density of 1×10⁶ cells/ml in 6-well plates.

MCF-7 cells (5×10³/well) were plated in 96-well plates and cultured overnight. MTT solution (volume, 20 µl; concentration, 5 mg/ml; Sigma-Aldrich) was added to each well and then incubated for another 4 h. The supernatant was removed and DMSO (150 µl) was added for test preparation. Absorbance was measured at 490 nm. Data were obtained from triplicate wells per condition.

Cells in 6-well plates were collected using 0.25% trypsase 24 h after chrysophanol treatment. Cells were washed twice with PBS butter and then resuspended in 250 µl of binding buffer. Cells were fixed in 1% paraformaldehyde for 24 h and then stained with 5 mg/ml propidium iodide for cell cycle analysis. Cells were stained with propidium iodide and Annexin V/FITC for cell apoptosis analysis. Stained cells were analyzed by FACS Calibur flow cytometer (BD Biosciences, San Diego, CA, USA) after incubation in the dark for 15 min.

Total protein of MCF-7 cells was extracted using lysis buffer (Pierce Biotechnology, Inc., Rockford, IL, USA) and Bradford method was used to quantify the protein. When SDS-PAGE assay was performed, 30 µg of the protein was separated and then transferred to polyvinylidene fluoride membranes (Millipore Corp., Billerica, MA, USA). For primary antibody incubation, cleaved caspase 3, caspase 3, cleaved PARP, PARP, p-p65, p65, p-IκB, IκB, Bcl-2 (1:1,000; Cell Signaling Technology, Inc., Danvers, MA, USA), and GAPDH (1:2,000; Cell Signaling Technology, Inc.) were incubated overnight at 4°C. For secondary antibody incubation, peroxidase-coupled anti-mouse/rabbit IgG (1:1,000; Cell Signaling Technology, Inc.) was incubated at 37°C for 2 h. Sample protein was visualized using ECL (Pierce Biotechnology, Inc.) and detected using a DNR BioImaging System (DNR Bio-Imaging Systems, Ltd., Jerusalem, Israel). Relative protein levels were quantified using ImageJ software.

Total RNA was isolated from MCF-7 cells using TRIzol reagent (Thermo Fisher Scientific) following the manufacturer's instructions. Then, reverse transcription of total RNA into cDNA was performed using the Reverse Transcription System (A3500; Promega Corp., Madison, WI, USA) and PrimerScript RT Master Mix kit (Takara Bio, Dalian, China). Briefly, a total 20 µl of reverse-transcription reaction solution was prepared containing 4 µl of 5X RT Master Mix and 800 ng RNA and the mixture was reacted at 85°C for 2 min and 37°C for 30 min. PCR was performed using 7500 Realtime PCR System (Applied Biosystems Life Technologies, Foster City, CA, USA) and SYBR-Green master mix kit (Applied Biosystems Life Technologies). The relative expression of target genes were calculated as ΔCq=Cq gene-Cq reference, and the fold change of target gene expression was calculated by the 2^−ΔΔCq method. GAPDH was used as the reference gene. Experiments were repeated in triplicate. Primer sequences were listed as follows: Cyclin D1 forward TGGAGGTCTGCGAGGAACA, cyclin D1 reverse TTCATCTTAGAGGCCACGAACAT; cyclin E forward AGCCAGCCTTGGGACAATAAT, cyclin E reverse GAGCCTCTGGATGGTGCAAT; p27 forward CTGCAACCGACGATTCTTCTACT, p27 reverse CTTCTGAGGCCAGGCTTCTT; GAP DH forward AAGATCATCAGCAATGCCTCCT, GAP DH reverse TGGTCATGAGTCCTTCCACGAT.

Statistical analyses were performed using SPSS version 16 for Windows. The Student's t-test was used to compare differences between control and treatment groups. P<0.05 was considered to indicate a statistically significant difference.

MCF-7 and MDA-MB-231 cells were employed to explore effect of chrysophanol on breast cancer. Cells were treated with chrysophanol at the concentrations of 0, 5, 10, 20 µM. MTT assay and cell cycle analysis were performed. As shown in Fig. 1A, proliferation rates of MCF-7 and MDA-MB-231 cells were decreased significantly when treated with chrysophanol in a concentration-dependent manner after 48 h treatment. Cycle analysis results showed that G1 percentage increased while S percentage decreased after chrysophanol treatment (24 h) in a concentration-dependent manner (Fig. 1B), indicating chrysophanol could arrest breast cancer cells at G1-S cell cycle checkpoint.

Western blot analysis and real-time quantitative PCR were used to determine the change of cycle related genes (Fig. 2). Western blot analysis results showed that chrysophanol exposure dramatically inhibited expression of cyclin D1, cyclin E while upregulated p21 levels in a concentration dependent manner in both MCF-7 and MDA-MB-231 cell lines (0, 5, 10, 20 µM, 24 h) (Fig. 2A). In accordance with western blot analysis results, PCR results showed cyclin D1 and cyclin E mRNA levels decreased when treated with chrysophanol. The mRNA expression of p27 was upregulated in both cell lines in a dose dependent manner (0, 5, 10, 20 µM, 24 h) (Fig. 2B).

To explore effect of chrysophanol on cell apoptosis, MCF-7 and MDA-MB-231 cells were treated with chrysophanol (20 nM, 24 h) and stained with Annexin V/PI. As shown in Fig. 3 A&B, percentage of apoptotic cells was increased significantly when treated with chrysophanol in both cell lines. In order to explore the role of chrysophanol on chemosensitivity, we adopted 5 nM paclitaxel (PTX) to treat MCF-7 and MDA-MB-231 cell lines for 12 h and examined apoptosis rate after chrysophanol (20 nM, 24 h) treatment. As shown in Fig. 3A and B, chrysophanol significantly increased apoptosis rate in paclitaxel treated breast cancer cells.

Next, expression of apoptosis related protein was examined using western blot analysis and the results showed that chrysophanol treatment upregulated cleaved caspase 3 and cleaved PARP levels in both cell line (Fig. 4). In cells treated with paclitaxel (5 nM, 12 h), chrysophanol also significantly upregulated caspase 3 and PARP cleavage in both cell lines (Fig. 5).

To explore the potential mechanism of chrysophanol in MCF-7 and MDA-MB-231 cell lines, we examined several signaling pathways which is related to cancer cell proliferation and chemoresistance. Western blot analysis showed that expression of Bcl-2, p-IκB, p-p65 expression were significantly decreased after treatment with chrysophanol (Fig. 4).

The above results demonstrated that NF-κB activity was suppressed after chrysophanol treatment. Bcl-2 was reported as a downstream target of NF-κB signaling, which serves as a potent inhibitor of apoptosis and an indicator of chemoresistance. To confirm if chrysophanol mediated cell behavior was dependent on NF-κB signaling pathway, cancer cells were treated with NF-κB inhibitor (10 µM). Apoptosis analysis was performed and the results showed that difference of PTX induced apoptosis rate between control+ PDTC and chrysophanol+PDTC groups was not as significant as that between control and chrysophanol groups (Fig. 6). As shown in Fig. 7, PDTC blocked NF-κB signaling by reducing p-p65 and p-IκB expression. Apoptosis analysis was performed and the results showed that difference of PTX induced apoptosis rate between control+ PDTC and chrysophanol+PDTC groups was not as significant as that between control and chrysophanol groups (Fig. 6 A&B). In addition, in PDTC treated cells, the role of chrysophanol on Bcl-2 reduction was not significant, suggesting chrysophanol induced chemosensitivity through inhibition of NF-κB/Bcl-2 signaling (Fig. 7).