A total of 15 pairs of atherosclerotic lesion tissues and normal veins were obtained during treatment from 15 patients at Dongyang People's Hospital. All tissues were immediately stored in liquid nitrogen until use. All the protocols were approved by the Ethics Committee of Dongyang People's Hospital. Informed consent was obtained from each patient.

The human aortic endothelial cells (HAECs) were cultured in RPMI-1640 medium supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 1% penicillin/streptomycin. All cells were incubated in a humidified incubator at 37°C and 5% CO_2.

Ox-LDL was used to establish the atherosclerotic cell model. Native LDL (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) was oxidized by exposure to CuSO4 (5 µmol/l free Cu2+ concentration) in PBS at 37°C for 24 h. HAECs were treated with 50 µg/ml ox-LDL for 24 h.

The miR-34a mimic (50 nM), miR-34a inhibitor (50 nM), the negative control (50 nM) (Shanghai GenePharma Co., Ltd., Shanghai, China), 1 µg Control-siRNA (empty vector), 1 µg HDAC1-siRNA (Santa Cruz Biotechnology, Inc., Dallas, TX, USA) or 50 nM miR-34a inhibitor+1 µg HDAC1-siRNA, was transfected into HAECs respectively using 30 µl Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer's instructions. Transfected cells were incubated at 37°C in an atmosphere of 5% CO2 for 48 h.

Total RNA of atherosclerotic tissues or HAECs was extracted by using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), and cDNAs were synthesized using miScript Reverse Transcription kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer's instructions. The primers for reverse transcription and amplification of miR-34a, HDAC1 and U6 were designed and synthesized by GenScript Co., Ltd., (Nanjing, China). Quantitative real-time PCR was conducted to detect miR-34a and HDAC1 mRNA using the SYBR Premix Ex Taq™ II (TliRNaseH Plus) kit (Takara Biotechnology Co., Ltd., Dalian, China) using the Bio-Rad Laboratories, Inc., (Hercules, CA, USA) machine, with the U6 small nuclear RNA and GAPDH as internal normalized references, respectively. The primer sequences for qPCR were as follows:U6-Forward: 5′AAAGCAAATCATCGGACGACC3′; U6-Reverse: 5′GTACAACACATTGTTTCCTCGGA3′; GAPDH-Forward: 5′GAAGGTGAAGGTCGGAGTC3′; GAPDH-Reverse: 5′GAAGATGGTGATGGGATTTC3′; miR-34a-Forward: 5′CAGCCTGGAGGAGGATCGA3′; miR34a-Reverse: 5′TCCCAAAGCCCCCAATCT3′; HDAC1-Forward: 5′CTACTACGACGGGGATGTTGG3′; HDAC1-Reverse: 5′GAGTCATGCGGATTCGGTGAG3′. The 2^−ΔΔCq method was applied to quantify the relative gene expressions (12).

Cell Count Kit-8 assay (CCK-8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan) was used as a qualitative marker for cell viability. After 48 h transfection with miR-34a mimic, miR-34a inhibitor, the negative control or miR-34a inhibitor+ HDAC1-siRNA, HAECs were seeded into 96 well plates in triplicate at 5×10³ cells per well. At 0, 24, 48, and 72 h, 10 µl of CCK-8 solution mixed with 90 µl of RPMI-1640 was added to each well. And after 2 h of incubation, the absorbance was measured at 570 nm.

HAECs were transfected with miR-34a mimic, miR-34a inhibitor, the negative control or miR-34a inhibitor+ HDAC1-siRNA, and 48 h after transfection, the cells then were subjected to apoptosis assay. Then 106 treated cells were stained with Annexin V and PI using an apoptosis detection kit (BD Biosciences, Franklin Lakes, NJ, USA). According to the manufacturer's instructions, after incubation for 15 min in the dark, cell apoptosis were then detected by flow cytometry.

For confirmation of direct target binding, the wild type and mutant 3′UTR of HDAC1 identified by TargetScan was cloned into a pmiR-RB-ReportTM dual luciferase reporter gene plasmid vector (Guangzhou RiboBio Co., Ltd., Guangzhou, China). The UTR region of candidate target gene was inserted downstream of the sequence of renilla luciferase, which is designed for reporter fluorescence. For luciferase reporter analysis, HAECs were co-transfected with luciferase reporter vectors and control mimic or miR-34a mimic using Lipofectamine 2000. After 48 h, luciferase activity was analyzed by the dual-luciferase assay system (Promega Corporation, Madison, WI, USA) according to the manufacturer's protocols.

HAECs were transfected with miR-34a mimic, miR-34a inhibitor, the negative control or miR-34a inhibitor+ HDAC1-siRNA for 48 h, then cells were collected and total proteins were extracted in 40 mM Tris-HCl (pH 7.4) containing 150 mM NaCl and 1% (v/v) Triton X-100, supplemented with protease inhibitors. Protein concentration was determined using the bicinchoninic acid protein assay (Pierce; Thermo Fisher Scientific, Inc.). Equal amounts of protein were resolved on 10% SDS-PAGE gels, and then transferred to a PVDF membrane (EMD Millipore, Billerica, MA, USA). After blocking with 5% skimmed milk in TBST, then probed with antibodies against Bcl-2 (cat no. 4223; dilution: 1:1,000), procaspase-3 (cat no. 9664; dilution: 1:1,000), procaspase-9 (cat no. 9501; dilution: 1:1,000), c-Myc (cat no. 13,987; dilution: 1:1,000); p21 (cat no. 2947; dilution: 1:1,000); β-actin (cat no. 4970; dilution: 1:1,000) (all from Cell Signaling Technology, Inc., Danvers, MA, USA), membranes were subsequently incubated with horseradish peroxidase (HRP) conjugated secondary antibody (Anti-rabbit IgG, HRP-linked Antibody; cat no. 7074; dilution: 1:5,000). Immunoreactive bands were visualized using the enhanced chemiluminescence detection system. The protein levels of the stripes were normalized based on the gray value of β-actin.

SPSS v17.0 software was used to analyze the data. Values are expressed as mean ± SD of experiments performed in triplicate. Data were analyzed by one-way ANOVA or Student's t-test. P<0.05 was considered to indicate a statistically significant difference.

Fifteen pairs of atherosclerotic lesion tissues and normal veins were recruited in this study. Q-RT PCR result showed that compared to the normal veins, the expression of miR-34a were significantly increased in atherosclerotic lesion tissues (Fig. 1A). In addition, Ox-LDL induction significantly increased the expression of miR-34a in HAECs (Fig. 1B). These data suggest that miR-34a is highly expressed in atherosclerosis.

We next studied the expression of HDAC1 in atherosclerosis, and we found that the expression of HDAC1 was reduced both in atherosclerotic lesions and Ox-LDL treated HAECs (Fig. 2A-D).

For further study the role of miR-34a in atherosclerosis, miR-34a mimic, miR-34a inhibitor, the negative control (NC), Control-siRNA (empty vector), HDAC1-siRNA, or miR-34a inhibitor+HDAC1-siRNA was transfected into HAECs respectively, the transfection efficiency was detected by qRT-PCR and western blotting (Figs. 2E and 3).

We used TargetScan to predict the potential targets of miR-34a, HDAC1 was identified as a potential miR-34a target gene (Fig. 4A). And the luciferase reporter assay showed that the luciferase activity was significantly reduced in the HAECs co-transfected of miR-34a with HDAC1-UTR-WT reporter plasmids, but co-transfection of miR-34a with HDAC1-UTR-MUT reporter plasmids did not (Fig. 4B). To further confirm that miR-34a regulates HDAC1 expression in HAECs, miR-34a mimic, miR-34a inhibitor and negative control (NC) were transfected into HAECs. The results showed that miR-34a mimic significantly inhibited the expression of HDAC1, and miR-34a inhibitor significantly enhanced the expression of HDAC1 (Fig. 4C and D). Together, these data indicate that miR-34a directly target HDAC1.

Given our limited understanding of the role played by miR-34a in HAECs, we examined the effects of miR-34a gain and loss-of-function on atherosclerosis. The CCK-8 results showed that Ox-LDL induction significantly reduced the viability of HAECs, and when compared with ox-LDL treatment alone, miR-34a inhibitor significantly enhanced the cell viability of HAECs, whereas HDAC1-siRNA eliminated the increased viability of HAECs induced by miR-34a inhibitor (Fig. 5). These results indicated that miR-34a inhibitor enhances the cell viability of HAECs through regulating HDAC1.

Flow cytometry analysis demonstrated that cell apoptosis were increased in Ox-LDL induction HAECs compared to the control group. Compared with ox-LDL treatment alone, miR-34a inhibitor significantly reduced the apoptosis of HAECs, whereas HDAC1-siRNA eliminated the decrease of apoptosis of HAECs induced by miR-34a inhibitor (Fig. 6). Together, these data indicated that miR-34a inhibits cell grow and promotes apoptosis of HAECs via regulating HDAC1.

To further investigate the molecular mechanism of the miR-34a effects on HAECs, the expression of apoptosis-related genes were detected by western blotting. The results showed that miR-34a inhibitor significantly increased the expression of Bcl-2, procaspase-3, procaspase-9 and c-Myc, and the expression of p21 was significantly decreased compared with ox-LDL treatment alone. In addition, HDAC1-siRNA eliminated the effects induced by miR-34a inhibitor (Fig. 7). It is further demonstrated that miR-34a regulates the expression of apoptosis-related proteins by targeting HDAC1.