HepG2 (American Type Culture Collection, Manassas, VA, USA; HB-8065) and Huh7 (JCRB Cell Bank, National Institutes of Biomedical Innovation, Health and Nutrition, Osaka, Japan; 0403) cells were cultured in Dulbecco's modified Eagle's medium/F12 (Life Technologies; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal bovine serum (Life Technologies; Thermo Fisher Scientific, Inc.), 2 mM L-glutamine, 100 U/ml penicillin, and 100 µg/ml streptomycin, at 37°C in humidified air containing 5% CO₂. For HepG2.2.15, 300 µg/ml geneticin (Invitrogen; Thermo Fisher Scientific, Inc.) was added. HepAD38 (American Type Culture Collection; CRL-12077) is tetracycline-inducible HBV-producing cell line, in which HBV expression is suppressed by tetracycline. Tetracylcine (cat no. 250163) and entecavir (cat no. SML1103) were purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany). The cell culture of HepaRG cells (cat no. HPR101; Biopredic International, Saint Grégoire, France) and primary human hepatocytes (Bioreclamation IVT, Hicksville, NY, USA) was performed as previously described (20,21). The cells seeded into 12-well and 96-well plates were at a density of 2×10⁵ and 3×10⁴, respectively, if not explicitly stated otherwise. The cells were infected with 50 genome equivalents of purified HBV virus from HepAD38 cells, constituted in 4% polyethylene glycol (PEG; cat no. P1458, Sigma-Aldrich, Merck KGaA) and 1% dimethyl sulfoxide (DMSO). After 16 h incubation at 37°C, cells were washed three times with PBS and replenished with William's E medium (cat no. 32551-020; Life Technologies, Thermo Fisher Scientific, Inc.) supplemented with primary hepatocyte maintenance supplements (cat no. CM4000; Life Technologies; Thermo Fisher Scientific, Inc.) for primary human hepatocyte cell culture, or additives (cat no. ADD710; Biopredic International, Saint Grégoire, France) for HepaRG cells. DMSO, (cat no. D2650) and PI3K-AKT-mTOR inhibitors Ly294002 (cat no. L9908), AKTi (cat no. A6730) and rapamycin (cat no. V900930) were purchased from Sigma-Aldrich (Merck KGaA). The inhibitors were dissolved in DMSO and diluted in the William's E or DMEM/F12 medium. The final concentration of DMSO was 1%. Control cells were treated with DMSO alone. In HBV natural infection, Ly294002 was either added 30 h prior to infection or 30 h subsequently. In HBV replicating cells, the inhibitors were treated for 4–5 days to monitor the effect of PI3K-AKT-mTOR inhibitors on HBV replication.

Plasmid pBR322-HBV1.3ayw, which was kindly provided by Dr. Qiang Deng in Pasteur Institute of Shanghai, contained 1.3-mer length of HBV genome. Small HBV surface antigen (SHBs; spanning nucleotide 157 to nucleotide 837 of HBV ayw genome) were cloned into pcDNA3.1 (+) vector (cat no. V79020; Invitrogen, Thermo Fisher Scientific, Inc.) with KpnI and XhoI. HBx (spanning nucleotide 1376 to nucleotide 1840 of HBV ayw genome) were cloned into pLVX-IRES-tdTomato vector (cat no. 631238; Clontech Laboratories, Inc., Mountainview, CA, USA) with XhoI and BamHI. The restriction enzymes were purchased from New England BioLabs, Inc. (Ipswich, MA, USA). To transduce HBx, the HBx-pLVX-IRES-tdTomato plasmid was used to produce lentivirus by NovoBio (Novobio Scientific, Inc., Shanghai, China). One day before transfection, 1×10⁵ cells were seeded into each well of 12-well plates. Plasmids (1 µg) and 3 µl X-tremeGENE™ HP DNA transfection reagent (cat no. 06366236001; Roche Diagnostics GmbH, Mannheim, Germany) were diluted in 200 µl Opti-MEM medium (cat no. 31985062; Life Technologies, Thermo Fisher Scientific, Inc.). Incubated for 15 min at room temperature and added the transfection complex to the cells in a dropwise manner. After 6 h incubation at 37°C, cells were replenished with 1 ml cell culture medium. The cells were incubated for 5 days post transfection with or without the presence of PI3K-AKT-mTOR inhibitors.

The DNA and RNA were extracted using a DNA Blood Mini kit (Qiagen GmbH, Hilden, Germany) and TRIzol reagent (Thermo Fisher Scientific, Inc.), respectively. The RNAs were reverse transcribed using a cDNA synthesis kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Plasmid pBR322-HBV1.3ayw, which contained 1.3mer HBV genome, was used as HBV DNA standard for PCR. Quantitative polymerase chain reaction (qPCR) analysis was performed using TaqMan qPCR Master Mix reagent (Roche Diagnostics, Basel, Switzerland). The primers used for HBV DNA quantification were: HBX forward, 5′-cccgtctgtgccttctcatc-3′; HBX reverse, 5′-tcggtcgttgacattgctga-3′; HBX probe, 5′-FAM+tcgcttcacctctgcacgtcgc+Black Hole Quencher^®-3′. The PCR cycling program was performed as follows: Denaturation at a temperature of 95°C for 10 min, followed by 45 cycles of amplification at a denaturation temperature of 95°C for 10 sec, an annealing temperature of 60°C for 10 sec, and an extension temperature of 72°C for 15 sec. The cycle of quantification (Cq) was obtained to determine the absolute quantification of HBV DNAs using a standard curve. The standard curve was generated by plotting Cq values vs. the concentrations of HBV DNA standard with the analysis method ‘Abs Quant/2nd Derivative Max for All Samples’ of the LightCycler480 software (Roche Diagnostics GmbH, Mannheim, Germany). HBV DNA copy numbers were calculated from Cq values fit on the HBV plasmid DNA standard curve by the LightCycler480 software.

Cells seeded in 12-well plates were lysed in 0.5 ml lysis buffer (50 mM Tris-HCl [pH 7.5], 150 mM NaCl, 0.5% CA-630, supplemented with a protease & phosphatase inhibitor cocktail, cat no. 78440, Thermo Fisher Scientific, Inc.) and treated with same procedure as previously described (22). The HBV capsids were blotted to enhanced chemiluminescence membranes (GE Healthcare, Chicago, IL, USA) by capillary transfer. The membranes were blocked with 10% non-fat milk in TBS-0.1% Tween 20 for 30 min. HBV capsids were detected with primary anti-core antibody (cat no. B0586; Dako, Agilent Technologies, Inc., Santa Clara, CA, USA). The membrane was incubated with 1:1,000 diluted primary antibody at 4°C with gentle shaking overnight. Following washing three times with TBST, the membrane was incubated with 1:2,000 diluted anti-rabbit antibody (cat no. 656120; Thermo Fisher Scientific, Inc.) at room temperature for 1 h. The blot was incubated with horse radish peroxidase (HRP) substrate (cat no. 34075; Thermo Fisher Scientific, Inc.) and imaged using the ChemiDoc touch imaging system (Bio-Rad Laboratories, Inc.). The HBV capsid DNA was transferred to nylon membranes and hybridized with digoxigenin-labeled DNA probes according to the standard procedure of southern blotting.

The HBV capsid DNAs were hybridized with DNA probes and detected by alkaline phosphatase-conjugated anti-digoxigenin antibody (23). For RNA detection, 5 µg tRNAs were resolved on a 1.5% agarose gel containing 0.66 M formaldehyde, transferred onto nylon membranes and detected with HBV RNA probes (22).

Cells were washed once with Tris-buffered saline (TBS) and lysed with radioimmunoprecipitation assay lysis buffer (cat no. 89,900; Thermo Fisher Scientific, Inc.) supplemented with a phosphatase and protease inhibitor cocktail (cat no. 78440; Thermo Fisher Scientific, Inc.). Total protein concentrations in the lysate were measured using a bicinchoninic acid protein assay kit (cat no. 23225; Thermo Fisher Scientific, Inc.). Cell lysates were mixed with 4× SDS loading buffer (cat no. NP0007; Thermo Fisher Scientific, Inc.) and 10 mM DTT, and were boiled for 5 min at 95°C. A total of 5 µg of protein was loaded onto each lane. The samples were subjected to 4–12% SDS-PAGE (cat no. NP0322; Thermo Fisher Scientific, Inc.) and were then transferred to nitrocellulose membranes (cat no. IB23001; Thermo Fisher Scientific, Inc.). The membranes were blocked with 10% nonfat milk (cat no. 9999; Cell Signaling Technology, Inc., Danvers, MA, USA) in TBS-0.1% Tween 20 for at least 30 min and were then incubated with the indicated primary antibodies. The primary antibodies used were as follows: β-actin (cat. no. A3854; Sigma-Aldrich; Merck KGaA), HBV core (cat. no. B0586; Dako; Agilent Technologies, Inc., Santa Clara, CA, USA), AKT (cat. no. 9272; Cell Signaling Technology, Inc., Danvers, MA, USA), p-AKT (cat. no. 9275; Cell Signaling Technology, Inc.), HBsAg (cat. no. 30R-AH018; Fitzgerald Industries International, North Acton, MA, USA), and HBx (kindly provided by Roche Innovation Centre Shanghai, Shanghai, China). The membrane was incubated with 1:1,000 diluted primary antibody at 4°C with gentle shaking overnight. The secondary antibodies, including anti-rabbit antibody (cat no. 656120) and anti-mouse antibody (cat no. 32430) were purchased from Thermo Fisher Scientific, Inc. Following washing three times with TBS, the membrane was incubated with 1:2,000 diluted secondary antibody at room temperature for 1 h. The blot was incubated with HRP substrate (cat no. 34075; Thermo Fisher Scientific, Inc.) and imaged using the ChemiDoc touch imaging system (Bio-Rad Laboratories, Inc.).

HepAD38 cells (8×10⁴) were seeded into each well of chamber slides (cat. no. 177445; Thermo Fisher Scientific, Inc.). Following treatment with the inhibitors for three days, cells were fixed with 4% paraformaldehyde at room temperature for 20 min. The samples were incubated for 10 min with PBS containing either 0.5% Triton X-100 at room temperature for 10 min, and then were washed three times with PBS for 5 min. Then, samples were incubated with HBsAg antibody (1:100; cat. no. 18–0023; Invitrogen; Thermo Fisher Scientific, Inc.) in PBST buffer supplemented with 5% normal serum for 2 h at room temperature, and washed three times with PBST buffer for 5 min. Samples were then incubated with goat anti-mouse antibody (1:400; cat. no. A28175; Invitrogen; Thermo Fisher Scientific, Inc.) at room temperature for 30 min in the dark and washed thrice with PBST buffer for 5 min. Samples were incubated with 100 nM DAPI in PBS buffer at room temperature for 5 min, and then cells were washed three times with PBS for 5 min in the dark. The cells were visualized with a Zeiss confocal microscope (Zeiss GmbH, Jena, Germany) at 400× magnification.

HBsAg and HBeAg in the culture medium and cell lysate were tested using Autobio CLIA kits (Autobio Co., Ltd., Zhengzhou, China; cat. nos. CL0310-2 and CL0310-2 for HBsAg and HBeAg, respectively), according to the manufacturer's protocol.

HBV DNA/RNA and HBsAg levels were quantified by PCR and CLIA assay respectively. Data represent the mean ± standard deviation of experiments performed in triplicate, and are presented as absolute copy numbers or relative to control (cells treated with DMSO). One-way analysis of variance was used with Dunn's multiple comparisons test (GraphPad Prism version 7.03 software; GraphPad Software, Inc., La Jolla, CA, USA) to compare the different groups in the present study. P<0.05 was considered to indicate a statistically significant difference.

In order to evaluate the AKT phosphorylation induced by the HBV entry process, differentiated HepaRG cells were utilized for HBV infection, and cell lysates were collected at different time points post-HBV infection. HBV cellular entry transiently activated AKT and resulted in AKT phosphorylation at threonine 308 as early as 1 h post-HBV infection (Fig. 1A). AKT phosphorylation peaked at 6 h post-HBV infection and gradually decreased at 22 h post-infection.

Furthermore, AKT activation was transiently inhibited by the PI3K inhibitor Ly294002 at 10 µM, at which concentration the AKT phosphorylation was markedly inhibited. HBV entry activated AKT at 36 h post-viral infection in primary human hepatocytes, as hypothesized (Fig. 1B). Inhibition of AKT phosphorylation exerted no effect on HBV cellular entry, as the HBV core protein level in the cell lysate was not affected at 36 h post-HBV infection (Fig. 1B). The results demonstrated that although the HBV cellular entry process was able transiently activate the AKT pathway, AKT phosphorylation was not essential for HBV entry compared with a variety of viruses (11–13). The HBV infection and compound treatment procedure is illustrated in Fig. 1C. The PI3K inhibitor Ly294002 was applied for 30 h prior to or following HBV infection. Quantification of HBV DNA and HBsAg levels at 12 days post-infection additionally indicated that transient inhibition of AKT phosphorylation with 10 µM Ly294002 had no effect on the HBV entry process (Fig. 1D).

First of all, the effect of PI3K-AKT-mTOR inhibitors was evaluated in HBV plasmid transfected HepG2 and Huh7 cells. All three inhibitors, including Ly294002, AKTi and rapamycin, promoted HBV DNA levels in the supernatant following 5 days of treatment (Fig. 2A). In HBV infected dHepaRG cells, prolonged treatment with PI3K-AKT inhibitors increased the extracellular HBV DNAs in addition to the intracellular HBV RNAs (Fig. 2B and C). The prolonged effect of Ly294002 on HBV replication was further confirmed in HepG2.2.15 cells. The PI3K inhibitor Ly294002 dose-dependently increased the levels of HBV capsids and capsid DNAs in the cell lysates (Fig. 2D). These results were consistent with previous studies (13,15), and demonstrated that the PI3K-AKT-mTOR pathway negatively regulates HBV replication.

In addition, HepAD38 cells were treated without tetracycline for 8 days to accumulate intracellular covalently closed circular (ccc)DNAs. The cells were treated with 200 nM entecavir and tetracycline for 5 days to inhibit reverse transcription and transcription from integrated HBV DNA, respectively. Transcripts from episomal cccDNA were not affected by treatment with entecavir and tetracycline. Lentiviruses were utilized to introduce HBx into HepAD38 cells. The effect of the PI3K-AKT-mTOR signaling pathway inhibitors on HBV transcription was evaluated. In entecavir- and tetracycline-treated HepAD38 cells, HBx expression was undetectable by western blotting (Fig. 2E). The PI3K-AKT-mTOR pathway inhibitors promoted HBV 3.5 kb pgRNA transcription in HBx-expressing cells, and exerted no effect on pgRNA transcription in HBx negative cells. The enhanced transcription was specific to 3.5 kb mRNAs, as it exerted no impact on the transcription of 2.4 kb and 2.1 kb S mRNAs (Fig. 2F). The results demonstrated that the PI3K-AKT-mTOR pathway inhibitors promoted HBV 3.5 kb pgRNA transcription in an HBx-dependent manner.

HepG2.2.15 cells were treated with PI3K-AKT-mTOR inhibitors for 4 days. Ly294002 was observed to be the only inhibitor which was able to decrease HBsAg levels in the cell culture medium (Fig. 3A). It was subsequently identified that Ly294002 was the only compound increasing intracellular HBsAg in HepG2.2.15 cells (data not shown). The results indicated that Ly294002 may block HBsAg secretion processes.

This HBsAg secretion inhibition capability of the PI3K inhibitor Ly294002 was further confirmed by immunofluorescence staining of HBsAg in HepAD38 cells (Fig. 3B). The results also indicated that Ly294002 blocked HBsAg secretion and increased the intracellular HBsAg level in a dose dependent manner. Western blot detection of intracellular HBsAg demonstrated that all of the four inhibitors intensively inhibited AKT phosphorylation. However, only Ly294002 blocked small HBsAg (SHBs) secretion, and exerted no effect on large HBsAg (Fig. 3C). In SHB plasmid-transfected HepG2 cells, following treatment with Ly294002, AKTi, rapamycin and wortmannin, only Ly294002 inhibited the secretion of sHBsAg (Fig. 3D and E). These results further demonstrated that the PI3K inhibitor Ly294002 may specifically inhibit the secretion of small HBsAg in a PI3K-AKT-mTOR pathway-independent manner.