Inflammation serves an important role in the progression of osteoarthritis (OA), and IL-1β may act as a catabolic factor on cartilage, reducing the synthesis of primary cartilage components type II collagen and aggrecan. Aquaporin 1 (AQP1) is a 28-kDa water channel formed of six transmembrane domains on the cell membrane. AQP1 is highly expressed in the anus, gallbladder and liver, and is moderately expressed in the hippocampus, ependymal cells of the central nervous system and articular cartilage. It was hypothesized that AQP1 may be highly expressed in OA cartilage and that it may increase the expression of catabolic factors during inflammatory OA progression. Therefore, the present study evaluated AQP1 functions in human OA articular chondrocytes. Primary chondrocytes were isolated from human hip and knee cartilage tissues, cultured and transfected with AQP1-specific small interfering RNA with or without subsequent IL-1β treatment.
Osteoarthritis (OA) is the most frequently diagnosed musculoskeletal disorder. It is a multifactorial and slowly progressing degenerative joint disease (
In mammals, the aquaporin (AQP) family consists of thirteen subtypes (AQP0 to 12) and these proteins are expressed in various tissues (
AQP1 is a membrane protein found in the red blood cells (
Several studies have demonstrated the expression of AQP1 and AQP3 in human articular cartilage (
OA cartilage tissues were obtained from the cartilage of lateral femoral condyles of patients with end-stage varus-type OA during total knee arthroplasty surgery (n=31). The diagnosis of OA was based on clinical, laboratory, and radiographic evaluations. These patients showed apparent macroscopic OA progression. As a control, normal chondrocytes (as determined macroscopically) were obtained from the hip cartilage of patients that underwent surgery for femoral neck fracture with no recorded tumor complication (n=12). All primary cartilage samples were obtained in accordance with the World Medical Association Declaration of Helsinki of ethical principles for medical research involving human subjects. The present study was approved by the ethical review board of Kobe University Graduate School of Medicine (Kobe, Hyōgo, Japan) and all patients provided written informed consent. The average age of OA patients in this study was 76.4 years, and the average age of patients with femoral neck fracture was 85.1 years, but there was no significant difference in age between the two groups.
Chondrocytes were isolated from the cartilage tissues and cultured. Previously, we have used OA chondrocytes isolated from the knee joint (
To evaluate the expression of different
The relative mRNA levels of human
The femoral condyles (n=5) and femoral head (n=5) were fixed in 4% paraformaldehyde for 24 h, dehydrated in graded alcohol solutions, decalcified with 14% EDTA for 7 days, and embedded in paraffin wax. Histological sections were obtained at 10-µm intervals.
Deparaffinized sections were digested with proteinase (Dako, Glostrup, Denmark) for 10 min and treated with 3% hydrogen peroxide (Wako Pure Chemical, Ltd., Industries, Osaka, Japan) to block endogenous peroxidase activity. The sections were treated with a 1:50 dilution of anti-AQP1 antibody (Santa Cruz Biotechnology, Inc., Dallas, TX, USA) at 4°C overnight, and subsequently treated with peroxidase-labeled anti-mouse immunoglobulin (Histofine Simple Stain MAX PO; Nichirei Bioscience, Tokyo, Japan) at room temperature for 30 min. The signal was developed as brown-reaction products using a peroxidase substrate 3,3′-diaminobenzidine (Histofine Simple Stain DAB solution; Nichirei Bioscience), and the sections were examined under a microscope. Hematoxylin stain was used as a counter stain. Numbers of AQP1-positive cells were counted in five areas of high-magnification fields at both the superficial and deep zones of the cartilage tissue by triple-blinded observers. The average percentage of AQP1-positive cells from the total cell count was calculated. Positive cells superior of the tidemark were included in the assessment.
Normal hip cartilages (n=3) were harvested under sterile conditions and explant pieces were placed in a culture dish containing DMEM with or without IL-1β. Forty-eight h after stimulation, the explants were fixed in 4% paraformaldehyde for 24 h, decalcified with 14% EDTA for 7 days, dehydrated in graded alcohol solutions, and embedded in paraffin wax. Histological sections were obtained at 10-µm intervals.
Chondrocytes were cultured in 6-well plates with or without stimulation with 10 ng/ml recombinant human IL-1β/IL-1F2 (cat. no. 201-LB; R&D Systems) for 12 h.
OA chondrocytes (n=7) were placed onto 6-well plates at a density of 2.0×105 cells/well in DMEM supplemented with 10% FBS and 100 U/ml of penicillin-streptomycin. After subculturing at 37°C for 24 h under 5% CO2, the medium was replaced with fresh serum-free medium, and chondrocytes were transfected with 0.5 nM of non-specific control siRNA (negative control no. 2 siRNA; cat. no. AM4613; Thermo Fisher Scientific, Inc.) or AQP1-specific siRNA (cat. no. 4390824, assay ID: s1515 or s1516) using the Lipofectamine RNAiMAX transfection reagent (cat. no. 13778150) (both from Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Twelve hours after transfection, the cells were treated with IL-1β.
OA chondrocytes (n=3) were lysed in a buffer containing 25 mM Tris, 1% Nonidet P-40, 150 mM NaCl, 1.5 mM EDTA, and a protease/phosphatase inhibitor mix (Roche Diagnostics, Basel, Switzerland). The lysates were centrifuged to remove cellular debris. The supernatants were collected, mixed with 4X electrophoresis sample buffer, electrophoresed on a 7.5–15% polyacrylamide gradient gel (Biocraft, Tokyo, Japan), and transferred onto a blotting membrane (GE Healthcare Life Sciences, Little Chalfont, UK). Membranes were incubated with antibodies against AQP1 or α-tubulin (cat. no. T9026; Sigma-Aldrich). Horseradish peroxidase (HRP)-conjugated goat anti-mouse immunoglobulin G antibody (IgG Ab) was used as a secondary antibody and proteins were visualized using the ECL plus reagent (GE Healthcare Life Sciences) in a Chemilumino Analyzer LAS-3000 mini (Fujifilm). Protein expression was determined by semi-quantification of digitally captured images using the NIH ImageJ software (
OA chondrocytes (n=3) were placed onto a glass-based dish (Iwaki, Tokyo, Japan) at a density of 2.0×105 cells/well in DMEM. Chondrocytes were transfected with non-specific control (0.5 nM) (Qiagen) or AQP1-specific siRNA-1 (0.5 nM) using the Lipofectamine RNAiMAX transfection reagent. Twelve hours after transfection, the cells were left untreated or stimulated with 10 ng/ml of recombinant human IL-1β/IL-1F2 (R&D Systems) for 12 h. After stimulation, the chondrocytes were fixed with 4% paraformaldehyde at room temperature for 30 min and permeabilized with 0.25% Triton X-100 (Nacalai Tesque, Kyoto, Japan) for 30 min. Fixed chondrocytes were then incubated with human anti-AQP1 mouse monoclonal antibody (1:50 dilution; Santa Cruz Biotechnology, Inc.) and mouse anti-ADAMTS-4 rabbit polyclonal antibody (1:500 dilution; Thermo Fisher Scientific, Inc.) in Can Get Signal immunostain Solution A (Toyobo, Osaka, Japan) overnight at 4°C. After the primary antibody incubation, the chondrocytes were incubated with goat anti-mouse immunoglobulin Alexa Fluor Plus 555 (1:200 dilution) and goat anti-rabbit immunoglobulin Alexa Fluor Plus 488 (1:200 dilution) (both from Thermo Fisher Scientific, Inc.) as the secondary antibodies for 60 min at room temperature. The nuclei were stained with DAPI (Nacalai Tesque), and images were viewed and captured using a BZ-X700 microscope (Keyence, Osaka, Japan). Numbers of AQP1-positive cells, ADAMTS-4-positive cells, and DAPI-stained nuclei were counted in four areas of high-magnification fields by triple-blinded observers. The average percentage of AQP1-positive cells and ADAMTS-4-positive cells from the total nuclei count was calculated.
The Mann-Whitney U test for comparisons between two groups and one-way analysis of variance with Tukey-Kramer's post hoc test were applied to analyze differences between time points or between culture conditions. P-values <0.05 indicated statistically significant differences. Results are presented as mean values ± standard error (SE) with 95% confidence intervals (CI). Data analysis was performed using the Bell Curve for Excel software (Social Survey Research Information Co., Ltd., Tokyo, Japan).
The expression of various
RT-qPCR analysis showed that the level of
To investigate the functions of AQP1 in chondrocytes, two AQP1-specific siRNAs were used to transfect the OA chondrocytes with or without IL-1β stimulation. IL-1β stimulation significantly increased the level of
To investigate the relationship between AQP1 and ADAMTS-4, we assessed AQP1 and ADAMTS-4 expression with or without IL-1β stimulation in human articular chondrocytes using immunofluorescence. Representative single-color images showing DAPI, AQP1, and ADAMTS-4 staining, as well as merged images are shown (
Geyer
Recent reports have also described various AQP1 functions other than its role in water-dependent homeostasis (
ACAN is the principal cartilage extracellular matrix proteoglycan that gives cartilage its characteristic compressibility, while ADAMTS is a family of proteases (
Recently, Graziano
Our study had several limitations. First, synovial fluid is produced in the synovium, and AQP is known to function in water metabolism in tissues. However, AQP1 functions in the synovial tissue were not assessed in the present study and should be addressed in a future study. Second, a previous report showed that AQP1 expression positively correlated with caspase-3 expression and activity, suggesting that AQP1 promoted caspase-3 activation and thereby contributed to chondrocyte apoptosis and the development of OA (
In conclusion, we demonstrated that AQP1 was highly expressed in the superficial to middle zones of OA articular cartilages, and the level of
The authors thank Mr. Takeshi Ueha, Ms. Kyoko Tanaka, Ms. Minako Nagata, and Ms. Maya Yasuda for their technical assistance, and Dr. Kazunari Ishida (Kobe Kaisei Hpspital) and Dr. Naoko Shima (Hyogo Prefectural Rehabilitation Central Hospital) for kindly providing the cartilage tissues. We would like to thank Editage (
AQP expression in human articular cartilage. (A) The expression of various
AQP1 immunohistochemistry of normal hip and OA cartilages. (A) Sections were unstained (secondary antibody only) or stained with anti-AQP1 antibody, and counterstained with hematoxylin and evaluated. Representative immunohistochemistry images and (B) the percentage of AQP1-positive cells in normal hip and OA articular cartilages (no. of positive cells/number of total cells with 95% CI) are shown. (C) Representative AQP1 immunohistochemistry images of hip explant cartilages and (D) the percentage of AQP1-positive cells in the cartilages (relative to the total cell numbers with 95% CI) are shown. Scale bars, 100 µm. AQP1, aquaporin 1; OA, osteoarthritis; CI, confidence interval; IL, interleukin.
Effects of IL-1β stimulation on the expression of
Effects of AQP1-specific siRNA transfection on IL-1β-induced expression of catabolic factors in OA chondrocytes. OA chondrocytes were transfected with two different AQP1-specific siRNAs for 12 h and then stimulated without (IL-) or with IL-1β (IL+) for 12 h. (A)
Immunostaining of OA human articular chondrocytes. DAPI, AQP1 and ADAMTS-4 staining are shown in blue, red and green, respectively. (A) OA articular chondrocytes were either transfected with non-specific control siRNA (siNC) without (IL-) or with IL-1β stimulation (IL+) for 12 h, or transfected with siAQP1 with IL-1β stimulation (IL+) for 12 h. The percentage of (B) AQP1- and (C) ADAMTS-4 positive cells (percentage of positive cells relative to DAPI-stained nuclei count with 95% confidence interval) is shown. Scale bar, 100 µm. Data are presented as the mean ± standard error (n=3). *P<0.001, as indicated. AQP1, aquaporin 1; siRNA/NC, small interfering RNA/negative control; siAQP1, AQP1-specific siRNA; IL, interleukin; OA, osteoarthritis; ADAMTS-4, a disintegrin and metalloprotease with thrombospondin motifs 4; DAPI, 4′,6-diamidino-2-phenylindole.
Sequence of primers used in reverse transcription- and reverse transcription-quantitative polymerase chain reaction.
Primer sequence (5′-3′) | ||
---|---|---|
Gene | Forward | Reverse |
GTTCGACAGTCAGCCGCATC | GGAATTTGCATGGGTGGA | |
TGTACTGGGTAGGCCCAATC | CCCCTCCACGTAAACTCAGA | |
TGGACACCTCCTGGCTATTG | GGGCCAGGATGAAGTCGTAG | |
CACCCCTGCTCTCTCCATA | GAAGACCCAGTGGTCATCAAAT | |
GCTGTATTATGATGCAATCTGGC | TAAGGGAGGCTGTGCCTATG | |
GAAGGCATGAGTGACAGACC | ATTCCGCTGTGACTGCTTTC | |
GCCACCTTGTCGGAATCTAC | TAAAGCATGGCAGCCAGGAC | |
CACCTCATTGGGATCCACTT | GTTGTAGATCAGTGAGGCCA | |
ATCTCTGGAGCCCACATGAA | GAAGGAGCCCAGGAACTG | |
GTGCCTGTCGGTCATTGAG | CAGGGTTGAAGTGTCCACC | |
TCTCTGAGTTCTTGGGCACG | GGTTGATGTGACCACCAGAG | |
GATAGCCATCTACGTGGGTG | CACAGAAAGCAGACAGCAAC | |
TCCGAACCAAGCTTCGTATC | TAGCGAAAGTGCCAAAGCTG | |
ACTTGTTCTTCTGGCCGTAG | CTTACTGGAGTACGTGCAGG | |
ATTCCATGGAGCCAGGCTTTC | CATTTGGGTCAAACTCCAACTGTG | |
TGCTGCATTCTCCTTCAGGA | ATGCATCCAGGGGTCCTGGC | |
GGCTAAAGCGCTACCTGCTA | GAGTCACCACCAAGCTGACA | |
TATGACAAGTGCGGACTATG | TTCAGGGCTAAATAGGCAGT | |
CCCAGAGGTGACAAAGGAGA | CACCTTGGTCTCCAGAAGGA | |
GGCACTAGTCAACCCTTTGG | CTGAACCCTGGTAACCCTGA |
AQP, aquaporin; MMP, matrix metalloproteinase; ADAMTS, a disintegrin and metalloprotease with thrombospondin motifs; COL2A1, cartilage components type II collagen; ACAN, aggrecan.