Contributed equally
Maintenance of the chondrocyte phenotype is crucial for cartilage repair during tissue engineering. Intraflagellar transport protein 88 (IFT88) is an essential component of primary cilia, shuttling signals along the axoneme. The hypothesis of the present study was that IFT88 could exert an important role in icariin-regulated maintenance of the chondrocyte phenotype. To this end, the effects of icariin on proliferation and differentiation of the chondrogenic cell line, ATDC5, were explored. Icariin-treated ATDC5 cells and primary chondrocytes expressed IFT88. Icariin has been demonstrated to aid in the maintenance of the articular cartilage phenotype in a rat model of post-traumatic osteoarthritis (PTOA). Icariin promoted chondrocyte proliferation and expression of the chondrogenesis marker genes, COL II and SOX9, increased ciliary assembly, and upregulated IFT88 expression in a concentration- and time-dependent manner. Icariin-treated PTOA rats secreted more cartilage matrix compared with the controls. Knockdown of IFT88 expression with siRNA reduced extracellular signal-regulated kinase (ERK) phosphorylation, and icariin upregulated IFT88 expression by promoting ERK phosphorylation. Thus, IFT88 serves a major role in icariin-mediated maintenance of the chondrocyte phenotype, promoting ciliogenesis and IFT88 expression by increasing ERK phosphorylation. Icariin may therefore be useful for maintenance of the cartilage phenotype during tissue engineering.
Articular cartilage injury can trigger joint pain and dysfunction. Cartilage exhibits a poor capacity for self-repair. Cartilage degeneration after trauma or during disease may readily trigger osteoarthritis (
Icariin is a monomeric compound identified in extracts of Herba Epimedii; the protein exhibits a cardioprotective effect, may be used to treat osteoporosis, and has aphrodisiac qualities (
Primary cilia are non-motile microtubular organelles protruding from the surfaces of most eukaryotic cells. Cilia serve as ‘antennae’, detecting mechanical stress, and they engage in biochemical signal transduction from the extracellular environment (
The progenitor chondrocytic cell line ATDC5 was purchased from the American Type Culture Collection (Manassas, VA, USA). Primary chondrocytes were obtained from the knee cartilage of 6 newborn (3 days old, 6–9 g) Sprague-Dawley (SD) rats of either sex (3 male and 3 female,). These SD rats were provided by the Experimental Animal Center (Tongji Hospital, Wuhan, China). All animals were maintained in the same housing conditions with free access to food and water (see below ‘Animal experiments’ section). Cells were cultured in Dulbecco's modified Eagle's medium/nutrient mixture F-12 (DMEM/F12) supplemented with 10% (v/v) fetal bovine serum (FBS) and 100 U/ml penicillin/streptomycin. Icariin was purchased from the Cayman Chemical Company (Ann Arbor, MI, USA). The ERK inhibitor, PD0325901, was obtained from Selleckchem (Houston, TX, USA).
The effect of icariin on ATDC5 cell proliferation was evaluated with the aid of a CCK-8 kit (Wuhan Boster Biological Technology, Ltd., Wuhan, China). Cells (2,000/well) were seeded into 96-well plates and cultured in 100 µl DMEM/F12 with 10% (v/v) FBS medium containing different concentrations of icariin (0.001–10 µmol/l). After 48 h, 10 µl amounts of CCK-8 solution were added to the wells, followed by incubation at 37°C for 90 min. Absorbance at 450 nm was measured using a microplate reader.
Chondrocytes (obtained from the aforementioned newborn rats) and the knee joints of 8-week old SD rats described below, were subjected to histochemical staining. Cells were fixed in 4% (v/v) paraformaldehyde for 15 min, and subsequently stained with 0.5% (v/v) toluidine blue. The knee joints were fixed in 4% (v/v) paraformaldehyde for 2 days, decalcified for 4 weeks in 10% (w/v) EDTA, embedded in paraffin, and stained with Safranin O-Fast Green and toluidine blue, following standard protocols. All immunohistochemical techniques followed were as described previously (
Chondrocytes at appropriate densities were inoculated on to coverslips. Using standard immunofluorescence methods, the primary cilia were stained with anti-acetylated α-tubulin antibody (cat. no. T7451; 1:300 dilution; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) or double-stained with that antibody together with an antibody against IFT88 (cat. no. AP11138b; 1:50 dilution; Abgent Inc., San Diego, CA, USA). CY3-conjugated goat anti-mouse, fluorescein isothiocyanate (FITC)-conjugated goat anti-rabbit immunoglobulin G (IgG) (cat. no. BA1031, 1:200 dilution; and cat. no. BA1105, 1:100 dilution; respectively; both from Wuhan Boster Biological Technology, Ltd.) served as secondary antibodies, and nuclei were stained with DAPI (1 µg/µl). Images were captured with a camera fitted to a fluorescence microscope.
Total cellular lysates were prepared with the aid of RIPA buffer. Samples of protein (20 µg) were loaded into lanes, separated on sodium dodecyl sulfate (SDS)-polyacrylamide 10% gels, and transferred to polyvinylidene difluoride (PVDF) membranes. The PVDF membranes were incubated with antibodies against IFT88 (cat. no. AP11138b; 1:200 dilution; Abgent Inc.), ERK and phosphorylated ERK (cat. nos. 9102 and 4370, respectively; both 1:1,000; both from Cell Signaling Technology, Inc., Danvers, MA, USA), and GAPDH (cat. no. BM3876; 1:400 dilution; Wuhan Boster Biological Technology, Ltd.); and subsequently with horseradish peroxidase (HRP)-labelled goat anti-mouse or goat anti-rabbit secondary antibody (cat. nos. BA1050 and BA1054, respectively; both 1:2,000 dilution, both from Wuhan Boster Biological Technology, Ltd.). Protein bands were detected using a Bio-Rad enhanced chemiluminescence system (Bio-Rad, Philadelphia, PA, USA).
ATDC5 progenitor chondrocytic cells were transfected with 100 nM siRNA targeting IFT88 or a negative control siRNA (Guangzhou RiboBio Co., Ltd., Guangzhou, China), using a standard protocol. Knockdown efficiency was evaluated by western blotting.
Expression levels of genes affecting the chondrocyte phenotype (COL-II, SOX9, and IFT88) were measured by qPCR. Total RNA was extracted with TRIzol and cDNAs were synthesized from 2 µg amounts of total RNA using a Toyobo cDNA synthesis kit (Toyobo, Co., Ltd., Osaka, Japan), according to the manufacturer's protocol. Each PCR tube contained 1 µl cDNA, 1 µl primers, 10 µl SYBR-Green DNA polymerase (Toyobo, Co., Ltd.), and 8 µl RNAse-free water. The primers sequences are listed in
The present study was approved by the Ethics Committee of Tongji Hospital (Wuhan, China). A total of 24 male SD rats (8 weeks old, 180–220 g) were divided into four groups (control, treadmill, icariin, and icariin + treadmill). Animals were purchased from the Experimental Animal Center, Tongji Hospital, (Wuhan, China). All these rats were maintained with free access to food and water, at a constant room temperature of 23±1°C with a 12 h light/dark cycle, 50–70% humidity and 0.03% CO2. Full-thickness cartilage defects were created, and early treadmill exercise was used to accelerate the development of post-traumatic osteoarthritis (PTOA). All rats underwent 1 week of treadmill training prior to surgery. Full-thickness cartilage defects were created by drilling a 1-mm-diameter hole through the middle of the femoral trochlea of the right knee, as described in a previous study (
All data are reported as the mean ± standard deviation, and means with 95% confidence intervals were calculated. Student's t-test or one-way analysis of variance was used to assess the significance of between-group differences. P<0.05 was considered to indicate a statistically significant difference.
Icariin at different concentrations, added to growing cells, promoted ATDC5 proliferation in a concentration-dependent manner, peaking at 1 µmol/l (
The primary cilia regulate numerous cellular activities, particularly the balance between proliferation and differentiation (
Primary chondrocytes were treated with icariin (10 µmol/l) for 24 h, and the levels of primary cilia and IFT88 were measured. IFT88 protein was detected in the cytoplasm, although it was principally centralized along the axonemes of primary cilia (
Toluidine blue and Safranin O-Fast Green staining revealed that the treadmill and treadmill + icariin groups exhibited reductions in cartilage thickness in weight-bearing areas, whereas the treadmill group lost more of the superficial cartilage proteoglycans than did the treadmill + icariin group. Icariin-treated and control rats had thicker cartilages that were rich in proteoglycans (
siRNA was used to knock down IFT88 gene expression, and this revealed that icariin rescued the reductions in COL-II and SOX9 expression levels induced by siRNA (
Maintenance of the cartilage phenotype is a major concern during cartilage tissue engineering. Although various biological materials and recombinant cytokines may be of assistance, these materials degrade rapidly, exhibit unpredictable side-effects, and are very costly (
IFT88, an intraflagellar transport protein, carries cargos into or out of primary cilia (
In conclusion, the present study explored the role exerted by the ciliary protein IFT88 in icariin-mediated maintenance of cartilage phenotype in progenitor cells and in primary chondrocytes. Icariin promoted ciliary assembly, enhanced intraflagellar transportation, induced ERK phosphorylation, and stimulated cartilage matrix secretion. Icariin thus aids in the maintenance of cartilage phenotype, and the present study has provided the theoretical basis for the use of icariin in cartilage tissue engineering.
This study was supported by the National Natural Science Foundation of China (grant nos. 81572094 and 81371915).
Icariin regulates ATDC5 cell proliferation and differentiation. (A) Icariin promoted ATDC5 cell proliferation in a concentration-dependent manner, peaking at 1 µmol/l. (B) Relative mRNA expression levels detected by real time-quantitative polymerase chain reaction. Icariin enhanced the expression of the cartilage phenotype-associated genes, COL-II and SOX9, peaking at 10 µmol/l. (C) Toluidine blue staining of the ECM (magnification ×100 or ×400). Icariin promoted ECM secretion. *P<0.05 compared with 0 µmol/l icariin. ECM, extracellular matrix.
Icariin promotes ciliary assembly and IFT88 expression. (A) Primary cilia were stained for acetylated-α-tubulin (red coloration, denoted by the white arrows; magnification, ×200). (B) The histograms reveal that, compared with the control group, 10 µmol/l icariin increased primary ciliary assembly (Control group, 27.91±9.95% cf. Icariin, 34.06%±10.06; *P<0.05), and icariin moderately increased the ciliary length from 3.07±0.74 to 3.34±1.34 µm. (C) Icariin increased IFT88 gene expression, peaking at 10 µmol/l (*P<0.05 cf. 0 µmol/l icariin). (D) Icariin upregulated production of the ciliary protein, IFT88, in a concentration- and time-dependent manner (*P<0.05 cf. 0 µmol/l icariin, or treatment at 0 h). IFT88, intraflagellar transport protein 88.
Icariin enhances primary ciliary assembly and maintains the phenotype of the primary chondrocytes. (A) Primary cilia were stained for acetylated-α-tubulin (red). Functional IFT88 (green) was widely dispersed in the cytoplasm, although it was principally centralized along the ciliary axonemes, which also contained acetylated α-tubulin (denoted by the white arrows; magnification, ×200). (B) Icariin increased the proportion of primary chondrocytes with cilia, from 29.54±8.24 to 38.48±10.36%, and led to a slight elongation of the cilia from 2.48±0.85 to 2.65±0.63 µm (*P<0.05). (C) Toluidine blue staining revealed that icariin promoted cartilage matrix secretion by primary chondrocytes. (D) Expression of phenotype-associated genes in primary chondrocytes (*P<0.05). IFT88, intraflagellar transport protein 88.
Icariin attenuates cartilage degeneration
Icariin regulates IFT88 expression via the ERK signalling pathway. (A) Quantitative polymerase chain reaction measuring the expression levels of the IFT88 and various phenotype-associated genes after transformation of IFT88 siRNA (*P<0.05 compared with the control group; ##P<0.01 compared with the icariin group). (B) IFT88 knockdown reduced the expression of phosphorylated ERK (**P<0.01 compared with the siCon group). (C) Icariin promoted expression of IFT88 and phosphorylated ERK, and slightly increased ERK phosphorylation, after transformation of IFT88 siRNA (**P<0.01 compared with the control group). (D) An ERK inhibitor reduced IFT88 expression. Icariin upregulated IFT88 expression, but could not restore such expression in the presence of the ERK inhibitor, PD0325901 (*P<0.05; **P<0.01 compared with the control group). ERK, extracellular signal-regulated kinase; IFT88, intraflagellar transport protein 88; Ica, icariin; PD, PD0325901, Con, control; T-ERK, total ERK; P-ERK, phosphorylated ERK.
Primer sequences.
Gene (rat) | Primer sequences (5′-3′) | Gene (mouse) | Primer sequences (5′-3′) |
---|---|---|---|
COLII | F: TCCTCCGTCTACTGTCCA | COLII | F: GCTCCCAACACCGCTAACG |
R: ACTTACCGGTGTGTTTCG | R: GCCGCTTCGTCCAGGTAGG | ||
SOX9 | F: TCGGGGCTCTACTCCACCT | SOX9 | F: GAGCCGGATCTGAAGAGGGA |
R: TCTGTCACCATTGCTCTTC | R: GCTTGACGTGTGGCTTGTTC | ||
IFT88 | F: ACCAGGCTGTAGACACATT | IFT88 | F: TGGCCAACGACCTGGAGATTAACA |
R: TTCTCGTAGTCACCATTTG | R: ATAGCTGCTGGCTTGGGCAAATTC | ||
GAPDH | F: CTGCTCCTCCCTGTTCTA | GAPDH | F: GCCTTCCGTGTTCCTACCC |
R: CAATGTCCACTTTGTCAC | R: GCCCTCAGATGCCTGCTTC |
R, reverse; F, forward; IFT88, intraflagellar transport protein 88.