THC (Hangzhou Haoxin Biotech, Co., Ltd., Hangzhou, China) was dissolved at a concentration of 200 µM in absolute dimethyl sulfoxide (DMSO) as a stock solution, which was stored at 4°C and was diluted with DMSO for the subsequent experiments. DMSO, tetramethylethylenediamine, ammonium persulfate, and acridine orange were purchased from Sigma-Aldrich, Merck Millipore (Darmstadt, Germany). RPMI-1640 medium, fetal bovine serum (FBS), penicillin and streptomycin antibiotics, and phosphate-buffered saline (PBS) were purchased from Gibco; Thermo Fisher Scientific, Inc. (Waltham, MA, USA). Tris-HCl and 4xTris-HCl were purchased from Shanghai Sangon Biotech Co., Ltd. (Shanghai, China). Additionally, 30% acrylamide/sis solution (30%) and sodium dodecyl sulfate (SDS) were purchased from Bio-Rad Laboratories, Inc. (Shanghai, China). Tris and Glycine were purchased from Amresco, LLC (Solon, OH, USA). Tween-20, methanol, and sodium chloride were purchased from Sinopharm Chemical Reagent Co. Ltd. (Shanghai, China). SDS-polyacrylamide gel electrophoresis (PAGE) protein loading buffer (5X), cell lysis buffer for western blotting and immunoprecipitation, phenylmethanesulfonyl fluoride, an ECL Plus Luminescence kit, and a BCA Protein Assay kit were purchased from Beyotime Institute of Biotechnology (Nantong, China). The Cell Counting Kit-8 (CCK-8), glyceraldehyde 3-phosphate dehydrogenase (GAPDH, MAB5465), goat anti-rabbit immunoglobulin G (IgG; GAR0072), and goat anti-mouse IgG (GAM007) secondary antibodies were purchased from MultiSciences Biotech Co., Ltd. (Shanghai, China). A high-purity total RNA rapid extraction kit was purchased from Generay Biotech Co., Ltd. (Shanghai, China). A PrimeScript™ RT reagent kit was purchased from TaKaRa (Dalian, China). SuperReal PreMix Color (SYBR^® Green) was purchased from Tiangen Biotech Co., Ltd. (Beijing, China). Akt (cat. no. 4691S), p-Akt (cat. no. 4060S), mTOR (cat. no. 2983S), p-mTOR (cat. no. 5536S), light chain (LC)3 I/II (cat. no. 4108S), p62 (cat. no. 13121S), PI3K (cat. no. 4249P), and p-PI3K (cat. no. 4228S) antibodies were purchased from Cell Signaling Technology, Inc. (Shanghai, China).

The A549 human lung adenocarcinoma epithelial cell line was purchased from the Cell Bank of Type Culture Collection of Chinese Academy of Sciences (Shanghai, China). The cells were cultured in RPMI-1640 supplemented with 10% FBS, penicillin G (100 U) and streptomycin (100 µg/ml). Cells were incubated in a humidified atmosphere containing 5% CO₂ at 37°C.

The CCK-8 assay was used to quantify the effect of THC on the cell viability of A549 cells. Cells were seeded in 96-well plates (5×10³ cells/well) in 90 µl medium for 24 h. The cells were subsequently treated cells with 10 µl of 0, 30, 70, 100 or 130 µM THC for 12, 24, 48 and 72 h. Following the THC treatment, 10 µl CCK-8 was added to each well and incubated for an additional 2 h at 37°C. The present study quantified cell viability at 490 nm using a plate reader (Molecular Devices, LLC, Sunnyvale, CA, USA).

To verify the effect of THC on autophagy in A549 cells, the present study quantified cellular autophagy using flow cytometry. A549 cells were seeded in 6-well plates (3×10⁵ cells/well) for 24 h and treated with 0, 10, 30, 70, 100 or 130 µM THC for 12, 24, 48, and 72 h. Cells were harvested, washed twice with cold PBS, and stained for 15 min at 4°C with acridine orange. The fluorescence intensity of the cells was detected using channels FL1 and FL3 of the flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA). The analyses were repeated three times. The autophagy rate (%) was calculated as follows: Autophagy rate (%)=(FL3/FL1) ×100.

Using TRIzol reagent, the present study treated total mRNA from the A549 cells with 0, 30, 70, 100 and 130 µmol/l THC for 24 h at 37°C. Following the THC treatment, the mRNA expression levels in A549 cells were determined using qPCR assay on a CFX Connect Real-Time PCR system (Bio-Rad Laboratories, Inc.). The present study extracted total RNA using a high-purity total RNA rapid extraction kit and synthesized the cDNA using a PrimeScript™ RT reagent kit; in an ice bath the RT reaction was mixed and then reacted at 37°C for 15 min and then at 85°C for 5 sec. The reaction was then stopped and stored at 4°C until use. Each sample was run in triplicate in a final volume of 20.0 µl containing 10 µl 2X SuperReal Color PreMix, 1 µl forward primer (10 µM), 1 µl reverse primer (10 µM) and 8 µl cDNA (β-actin forward, TGACGTGGACATCCGCAAAG, reverse, CTGGAAGGTGGACAGCGAGG; Beclin-1 forward, AAACCAGATGCGTTATGCCC and reverse, GCGACC CAGCCTGAAGTTAT). Cycling conditions for the qPCR were as follows: 1 cycle at 95°C for 15 min followed by 40 cycles at 95°C for 10 sec, 57°C for 15 sec, and 72°C for 15 sec. At the end of each reaction, a melting curve analysis was performed. β-actin was used as the reference gene, and the 2^−ΔΔCq method was used to determine the relative expression of each gene (17).

A549 cells (2×10⁵ cells/plate) were treated with 0, 30, 70, 100, and 130 µmol/l THC for 24 h at 37°C and lysed in cell lysis buffer for western blotting and immunoprecipitation. Proteins were quantified using the BCA Protein Assay kit. Protein (30 µg/lane) were subjected to 12% SDS-PAGE and transferred to a polyvinylidene fluoride membranes. The membranes were blocked with 5% non-fat milk for 1 h, followed by overnight incubation at 4°C with the following primary antibodies: Akt, p-Akt, LC3 I/II, mTOR, p-mTOR, p62, p-PI3K, and PI3K (all 1:1,000). Subsequently, the membranes were incubated with the corresponding horseradish-peroxidase secondary antibody, goat anti-rabbit IgG, and goat anti-mouse IgG (all 1:5,000) for 1 h at room temperature. The blots were developed and visualized using the ECL Plus Luminescence kit and ChemiDoc XRS+ System (Bio-Rad Laboratories).

Data are presented as the mean ± standard deviation. Student's t-test and one-way analysis of variance followed by a Tukey's post hoc test were used to analyze the data. Differences between experimental groups were assessed using SPSS version 19.0 (IBM Corporation, Armonk, NY, USA). P<0.05 was considered to indicate a statistically significant difference.

To evaluate the effects of THC on cell proliferation, A549 cells were treated with 0, 30, 70, 100, and 130 µM THC for 12, 24, 48 and 72 h. Cell viability was determined using a CCK-8 assay. A representative micrograph is presented in Fig. 2A (magnification, ×40). The inhibitory effect increased with higher THC concentration at 12 and 24 h. THC inhibited cell growth in a dose-dependent manner at each time point (Fig. 2B).

The aforementioned findings suggested that THC induced an autophagic response in A549 cells. Flow cytometry determined that THC-induced autophagy in A549 cells (Fig. 3).

Beclin-1 is associated with genes involved in the formation of autophagosomes and may influence the rate of autophagy. Following THC treatment in A549 cells, a dose-dependent increase in Beclin-1 expression was observed (P<0.05; Table I, Fig. 4).

The PI3K/Akt/mTOR molecular signaling pathway is involved in autophagy regulation, and suppression of the PI3K/Akt/mTOR pathway promotes autophagy. To examine the role of this pathway in THC-induced autophagy, the present study quantified the expression of mTOR, p-mTOR, Akt, p-Akt LC3-II/LC3-I, p62, PI3K, and p-PI3K using western blotting. Treatment with THC for 24 h led to a significant reduction in levels of p-mTOR, p-Akt and p62 compared to treatment for 12 h (Fig. 5). These findings indicate that the PI3K/Akt/mTOR pathway is involved in THC-induced autophagic cell proliferation inhibition via inhibition of Akt and mTOR phosphorylation.