Human HLE-B3 lens epithelial cells was were purchased from Jennio Biotech Co., Ltd. (Guangzhou, China) and the human 293T cell line was obtained from the Cell Bank of the Chinese Academy of Sciences (Shanghai, China). HLE-B3 and 293T cells were cultured in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin (all from both from Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA). Cell cultures were maintained in a humidified incubator at 37°C in a 5% CO₂ atmosphere.

The hsa-miR-181a-5p sequence was obtained from the miRBase database (http://www.mirbase.org). The lentivirus-based RNAi transfer plasmid pLKO. 1-puro-miR-181a (miR-181a-shRNA) targeting miR-181a (5′-AACAUUCAACGCUGUCGGUGAGU-3′) and the control plasmid pLKO. 1-puro were prepared using the pLKO. 1-puro plasmid obtained from the State Key Laboratory of Oncogenes and Related Genes, Shanghai Cancer Institute, Shanghai Jiao Tong University (Shanghai, China). To generate the pLKO. 1-puro-miR-181a, a miR-181a sponge was constructed using annealed oligonucleotides for tandem miR-181a-binding sites, as previously described (18). Briefly, the miR-181a sponge oligonucleotides (forward, 5′-CCGGACTCACCGACACGCATGAATGTTCCGGACTCACCGACACGCATGAATGTTCCGGACTCACCGACACGCATGAATGTTTTTTTT−3′ and reverse 5′-AATTAAAAAAAACATTCATGCGTGTCGGTGAGTCCGGAACATTCATGCGTGTCGGTGAGTCCGGAACATTCATGCGTGTCGGTGAGT-3′) were annealed using 50 pmol forward and reverse oligonucleotides, and 10X polymerase chain reaction (PCR) buffer (Takara Bio, Inc., Otsu, Japan), and cloned after the U6 promoter in the AgeI/EcoRI-digested pLKO.1-puro vector for the construction of pLKO.1-puro-miR-181a. The annealing conditions were as follows: 94°C for 3 min; followed by 55 cycles at 80°C for 30 sec with −1°C/cycle. The constructs were verified prior to use by sequencing by Sangon Biotech Co., Ltd. (Shanghai, China).

Lentivirus production and infection of the targeted cells were performed as previously described (19). Briefly, prior to transfection, 25×10⁶ 293T cells were plated onto 60×15 mm Petri dishes and grown to 80% confluence. The cells were then co-transfected with 3 µg psPAX2 packaging plasmid and 1 µg pMD2.G envelope plasmid (both from Invitrogen; Thermo Fisher Scientific, Inc.), along with 4 µg either pLKO.1-puro empty vector or pLKO.1-puro-miR-181a plasmid using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) as the transfection reagent, according to the manufacturer's protocol. Cells were cultured in serum-free DMEM for 6 h, following which the medium was replaced with DMEM supplemented with 10% FBS. The culture supernatants containing the lentiviral particles were collected at 48 and 72 h post-transfection. The supernatants were mixed, filtered by 0.45-µm filter and concentrated by ultracentrifugation at 4,000 × g for 20 min at 4°C. Viral supernatants were then aliquoted and stored at −80°C as a viral stock.

HLE-B3 cells were divided into the following 3 experimental groups: Normal control, negative control and shRNA-transfected groups. A total of 1×10⁵ cells were seeded in complete DMEM medium in a 24-well plate 24 h prior to transduction. Untreated HLE-B3 cells were used as the normal control group. The supernatant of the lentiviral particles containing the empty pLKO.1-puro vector was used to transduce the negative control cells for 24 h at 37°C, followed by the addition of fresh complete DMEM medium, HLE-B3 cells were infected with the supernatant of the recombinant lentivirus containing the miR-181a-shRNA for 24 h at 37°C, followed by the addition of fresh complete DMEM medium. Cells stably expressing the shRNA were obtained by puromycin selection at ~72 h using DMEM containing 2 µg/ml puromycin until the HLE-B3 cells all died in the control group. Confirmation of miR-181a knockdown was performed by reverse transcription-quantitative PCR (RT-qPCR).

Cell proliferation was evaluated by the colorimetric water-soluble tetrazolium salt assay, Cell Counting Kit-8 (CCK-8; Dojindo Molecular Technologies, Inc., Kumamoto, Japan), according to the manufacturer's protocol immediately following confirmation of successful knockdown (20). Briefly, control or stably transfected HLE-B3 cells were seeded (2×10⁴ cells/well) in 96-well round bottom plates immediately following transfection. Following overnight incubation at 37°C in serum-free medium, the cells were challenged with or without 200 µM H₂O₂ for 24 h at 37°C. Subsequently, 10 µl CCK-8 solution was added to each well and cells were incubated for another 4 h at 37°C. The number of viable cells was assessed by measuring the optical density values of the samples at 450 nm using a microplate reader (Molecular Devices, LLC, Sunnyvale, CA, USA).

Flow cytometry was used to assess cell apoptosis using an Annexin V-fluorescein isothiocyanate (FITC)/propidium iodide (PI) apoptosis detection kit (BD Biosciences, San Jose, CA, USA), according to the manufacturer's protocol. Briefly, control and stably transfected HLE-B3 cells were seeded (4×10⁵ cells/well) in 6-well plates. Cells were cultured in serum-free medium overnight at 37°C and subsequently challenged with or without 200 µM H₂O₂ for an additional 24 h at 37°C. Cells were trypsinized, collected by centrifugation at 500 × g at 4°C for 6 min, washed with phosphate-buffered saline (PBS) and resuspended in 1X binding buffer. For apoptosis detection, 5 µl annexin V-FITC and 5 µl PI were added to a culture tube containing 100 µl cell suspension and incubated for 15 min in a dark container at room temperature (25°C). Subsequently, 400 µl 1X binding buffer was added to each culture tube and the samples were assessed using a FACSCalibur flow cytometer with CellQuest software (version 5.1; BD Biosciences) within 1 h. Apoptotic cell populations were detected by flow cytometric analysis and the fractions of cell population were analyzed in different quadrants through the quadrant statistics, with the results being calculated as percentages of apoptotic cells.

Total RNA from normal and stably transfected HLE-B3 cells (5×10⁶ cells), with or without H₂O₂ treatment, was isolated using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The purity and concentration of RNA were determined using a NanoDrop spectrophotometer (NanoDrop Technologies; Thermo Fisher Scientific, Inc., Wilmington, DE, USA) and an Agilent 2100 Bioanalyzer (Agilent Technologies, Inc., Santa Clara, CA, USA). RT-qPCR was performed to evaluate the expression of the apoptosis-related genes caspase-3 (CASP3) and B-cell lymphoma-2-assciated X protein (BAX), and of the potential target genes for miR-181a c-MET, cyclooxygenase 2 (COX-2) and snail family transcriptional repressor 2 (SNAI2). β-actin was used as the internal control to normalize gene expression levels. Sequences of the specific primers used in the present study are presented in Table I. All primers were designed and synthesized by Takara Biotechnology Co., Ltd. (Dalian, China).

First-strand cDNA was synthesized using the PrimeScript First-Strand cDNA Synthesis kit (Takara Biotechnology Co., Ltd.) with Oligo-dT primers in a 20 µl reaction mixture containing 0.5 µg DNase-treated RNA, 4 µl 5X PrimeScript RT Master Mix and RNase-free water to a total volume of 20 µl, according to the manufacturer's protocol. The reaction was incubated at 37°C for 15 min and at 85°C for 5 sec. qPCR was performed on cDNA using Power SYBR Green PCR Master Mix in a 7500 Fast Real-Time PCR system (both from Applied Biosystems; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The PCR reaction volume was 20 µl, containing 10 µl 2X SYBR Premix Ex Taq, 10 µM of each primer, and diluted cDNA to a total volume of 20 µl. The thermocycling conditions were as follows: Initial denaturation at 50°C for 3 min and at 95°C for 30 min, followed by 40 cycles at 95°C for 10 sec and annealing at 60°C for 30 sec. The specificity was verified by melting curve analysis (60–95°C) following the 40 cycles of amplification. Each sample was analyzed in triplicate. The quantification cycle (Cq) was set within the exponential phase of the PCR and relative gene expression was calculated using the 2^−ΔΔCq method (21).

For quantification of miRNAs, a TaqMan MicroRNA reverse transcription kit (Applied Biosystems; Thermo Fisher Scientific, Inc.) was used according to the manufacturer's protocol. The primers used for miR-181a were as follows: miR-181a forward, 5′-GCGGCGAACATTCAACGATG-3′ and reverse, 5′-GTGCAGGGTCCGAGG−3′. Relative gene expression was calculated using the 2^−ΔΔCq method (21).

Control and stably transfected HLE-B3 cells were seeded (4×10⁵ cells/well) in 6-well plates. Cells were cultured in serum-free medium overnight at 37°C and subsequently challenged with 200 µM H₂O₂ or with nothing for an additional 24 h at 37°C. Cells were harvested and lysed by two rounds of sonication in 100 µl PBS (3 times for 10 sec) in an ice-water bath, incubated at −80°C for 30 min in between. Concentrations of MDA, SOD and CAT were measured using commercially available MDA ELISA kits (cat no. ml027131), SOD ELISA kit (cat no. ml026976), and CAT ELISA kit (cat no. ml026352) (all from Shanghai Enzyme-linked Biological Technology, Co., Ltd., Shanghai, China), according to the manufacturer's protocol. The absorbance of each sample was measured at 450 nm using a microplate reader (BioTek Instruments, Inc., Winooski, VT, USA).

All statistical analyses were performed using SPSS software version 17.0 (SPSS, Inc., Chicago, IL, USA). Data are expressed as the mean ± standard deviation of 3 independent experiments. The statistical significance of the differences between groups was assessed using Student's t-test for pair-wise comparisons or one-way analysis of variance followed by the Student-Newman-Keuls post hoc test for multiple comparisons. P<0.05 was considered to indicate a statistically significant difference.

Knockdown of miR-181a expression in HLE-B3 cells was performed using pLKO.1-puro-miR-181a lentiviral particles that express a miR-181a-targeting shRNA, whereas an empty pLKO.1-puro vector was used as a negative control. To test the knockdown efficiency, the expression of miR-181a was examined using RT-qPCR 48 h post-infection. The expression levels of miR-181a in miR-181a-shRNA-transfected cells were significantly decreased compared with expression levels in the normal control and negative control cells (P<0.001; Fig. 1A). These findings indicated that the construction of the HLE-B3 cell line in which miR-181a expression was stably silenced was successful.

To assess the effects of shRNA-mediated miR-181a silencing on cell proliferation and survival following H₂O₂ treatment, the growth of HLE-B3 cells was investigated in vitro. miR-181a knockdown significantly enhanced the proliferation of HLE-B3 cells compared with normal control cells (P<0.05; Fig. 1B). HLE-B3 cells treated with H₂O₂ (200 µM) exhibited a decrease in viability compared with untreated control cells (P<0.001; Fig. 1B). Notably, knockdown of miR-181a expression partially rescued H₂O₂-treated HLE-B3 cell viability, as compared with the untransfected H₂O₂-treated group (P<0.05; Fig. 1B); however, the proliferation of shRNA-transfected H₂O₂-treated cells remained significantly reduced compared with the control group (P<0.01; Fig. 1B). These findings suggested that shRNA-mediated miR-181a silencing may partially protect the viability of HLE-B3 cells against oxidative stress-induced compromise.

Decreased cell viability is closely associated with cell apoptosis (22); therefore, the present study examined whether the downregulation of miR-181a expression in HLE-B3 cells may exert a protective effect against H₂O₂-induced apoptosis. HLE-B3 cells infected with miR-181a-shRNA and treated with H₂O₂ appeared to be less susceptible to H₂O₂-induced damage, as indicated by the lower apoptotic rates compared with untransfected H₂O₂-treated cells (P<0.05; Fig. 2). However, no significant difference in the apoptotic rate was detected between the control and the shRNA-treated groups (P>0.05). These findings suggested that the downregulation of miR-181a expression in HLE-B3 cells may exert a protective effect against H₂O₂-induced apoptosis.

To assess the potential effects of shRNA-mediated miR-181a silencing on gene expression, mRNA expression levels of the apoptosis-associated genes CASP3 and BAX, and of the potential target genes for miR-181a c-MET, COX-2 and SNAI2 were detected. The results demonstrated that there were no significant differences in shRNA vs. con without treatment. The present results demonstrated that H₂O₂ exposure significantly increased the expression of CASP3, BAX and COX-2 compared with expression levels in the normal control group (P<0.001; Fig. 3A). Notably, following knockdown of miR-181a expression in H₂O₂-treated cells, the mRNA expression levels of BAX and COX-2 were significantly suppressed compared with in untransfected H₂O₂-treated cells (P<0.01 and P<0.001 respectively; Fig. 3A). Conversely, cells treated with miR181a-shRNA with or without H₂O₂ co-treatment exhibited no significant effects on the mRNA expression levels of c-MET or SNAI2 (P>0.05; Fig. 3B). These results suggested that shRNA-mediated miR-181a silencing may affect the expression of apoptosis-associated genes CASP3 and BAX, and of the putative COX-2 miR-181a target gene.

MDA is a product of lipid peroxidation and its intracellular levels are indicative of oxidative damage (14), whereas SOD and CAT are endogenous antioxidative enzymes (23). The levels of MDA, SOD and CAT in HLE-B3 cells from the various experimental groups are presented in Fig. 4. The results demonstrated that there were no significant differences in shRNA vs. con without treatment. The results demonstrated that in the presence of H₂O₂, the intracellular levels of MDA and CAT were significantly increased in HLE-B3 cells compared with expression in untreated control cells (P<0.001; Fig. 4A and C, respectively). Conversely, SOD expression levels were significantly reduced in cells following H₂O₂ treatment compared with untreated control cells (P<0.001; Fig. 4B). Notably, the levels of MDA were significantly suppressed in H₂O₂-treated cells following miR-181a knockdown compared with in untransfected H₂O₂-treated cells (P<0.01; Fig. 4A). Conversely, miR-181a-shRNA treatment exhibited no significant effects on the intracellular levels of SOD and CAT in the H₂O₂ co-treated group compared with the expression levels in the untransfected H₂O₂-treated cells (P>0.05; Fig. 4B and C, respectively). These results suggested that miR-181a knockdown may suppress the production of MDA following exposure to oxidative stress in vitro.