Lumbar disc disease (LDD) is common in aged populations, and it is primarily caused by intervertebral disc degeneration (IDD). Cartilage intermediate layer protein (CILP), which is specifically expressed in intervertebral discs (IVDs), is suspected to be associated with IDD. However, it remains unclear whether CILP contributes to IDD in humans. Furthermore, the regulation of CILP in human IVDs is poorly understood, especially by mechanical stimuli, which are regarded as primary factors promoting IDD. To address these issues, the present study collected nucleus pulposus (NP) cells from patients undergoing lumbar spinal surgery for degenerative disc disease (DDD). Subsequently, CILP expression was measured in human NP cells in response to mechanical stimuli, including cyclic compressive stress and cyclic tensile strain (CTS), by reverse transcription-quantitative polymerase chain reaction and western blotting. Aggrecan and collagen II, which are the main components of the extracellular matrix (ECM) and traditional degenerative markers for IDD, were detected following the treatment with CILP small interfering (si)RNA or recombinant human CILP (rhCILP) at various concentrations to determine whether CILP contributes to IDD by negatively regulating expression of the ECM. The results revealed that CILP expression in loaded NP cells was significantly increased compared with that in non-loaded cells under compressive loading, and that it was markedly decreased in cells under tensile loading, in contrast with the expression of aggrecan and collagen II in response to the same stimuli. Furthermore, CILP siRNA effectively inhibited CILP expression and significantly increased the expression of aggrecan and collagen II. In addition, treatment of NP cells with a high concentration of rhCILP resulted in significantly decreased expression of aggrecan and collagen II. In conclusion, these results demonstrated for the first time, to the best of our knowledge, that in human NP cells, CILP is regulated by mechanical stress and that its expression affects ECM synthesis. Therefore, CILP represents a promising therapeutic target for preventing loss of the matrix during IDD as a novel treatment strategy.
Lower back pain is a common disorder that has attracted much attention due to its effects on human health. Up to 80% of individuals worldwide may experience lower back pain at some point in their lives, of whom a large proportion receive surgery, resulting in heavy burdens on families and societies. Intervertebral disc degeneration (IDD) is regarded as a primary contributor to the pathological process of lower back pain (
Cartilage intermediate layer protein (CILP) is specifically expressed in intervertebral discs (IVDs) (
The development of IDD in humans is a complex process that involves cell autophagy, cellular senescence, invasion of inflammatory mediators, up-regulation of catabolic enzymes, such as matrix metalloproteinases (MMPs) and a disintegrin and metalloproteinase with a thrombospondin motifs (ADAMTs), and downregulation of matrix proteins, such as aggrecan and collagen II (
Although CILP has been suggested to interfere with the expression of matrix components, as mediated by several growth factors, in rabbit and mouse NP cells (
Rabbit monoclonal anti-human CILP (cat. no. ab192881), collagen II (cat. no. ab188570) and polyclonal anti-human aggrecan (cat. no. ab36861) antibodies were purchased from Abcam (Cambridge, MA, USA). rhCILP was obtained from R&D Systems (Minneapolis, MN, USA). Specific small interfering (si)RNA duplexes targeting human CILP and reduced-serum transfection medium were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA), and the siRNA transfection reagent was purchased from Invitrogen; Thermo Fisher Scientific, Inc. (Waltham, MA, USA).
Human IVDs were obtained with the approval of the Ethical Committee of Xinqiao Hospital (Chongqing, China) and with informed consent, in accordance with the Helsinki Declaration, from individuals undergoing surgery for IDD.
Human IVD tissues were collected from 20 patients (Male: Female, 1:1) ranging in age from 30–60 years who were undergoing lumbar spinal surgery for DDD at the Department of Orthopaedics between January 2016 and May 2016, The Second Affiliated Hospital (Chongqing, China). The NP tissues were carefully minced and digested to obtain NP cells, as previously reported (
An equal amount of each cell suspension was transferred onto a silicone membrane of a BioFlex 6-well tension plate (Flexcell International, Dunn Labortechnik, Asbach, Germany) at a density of 5×105 cells/well and were allowed to adhere for 48 h. The medium was replenished at 12 h before application of a CTS. A CTS of 10% at a 1.0 Hz frequency was delivered to the bases of the silicone membranes within the Bioflex culture plates using an FX-5000C™ Flexcell system, and NP cells adhered to the membranes via computer-controlled negative pressure for different durations (0, 6, 12, 24 and 48 h). Cells without tensile loading (control group) were cultured in the same culture plates as the cells in the stimulation groups. Mechanically stimulated and unstimulated NP cells were incubated at 37°C with 5% CO2 during stimulation.
Cell suspensions at a concentration of 2×106/ml were prepared in tubes and were then mixed with carbonate buffer solution (pH 5.5), maleimide-polymer (vinyl alcohol), water and PEG-Link according to the manufacturer's protocol (3D Life Dextran-PEG Hydrogel kit G90-1, Cellendes, Germany). The reaction was mixed via rapid vortexing for no more than 5 sec. Each cell suspension (1 ml) was obtained using a 1,000-µl pipette tip (Corning Incorporated, Corning, NY, USA) and a pipette (Eppendorf, Hamburg, Germany) prior to gel formation. The front end of the pipette tip was used to obtain a cross-section of 5 mm in diameter. The gel in the pipette tip was then extruded and sliced into cylinders with a height of 3 mm that were suitable for placement in the inner foam rings of Bioflex 6-well compression plates (Flexcell International, Dunn Labortechnik, Asbach, Germany). These cylinders were placed into the Bioflex plates according to the manufacturer's protocol. DMEM-F12 containing 10% serum was added to each plate to immerse the cylinders in medium. A compressive loading of 1–2.5 MPa at a 1.0 Hz frequency was delivered to the bases of the silicone membranes within the Bioflex plates using an FX-5000C™ Flexercell system and then to NP cells residing in the gel. The stimulation groups were subjected to stimuli for different periods of time (6, 12, 24 and 48 h), and cells without a tensile load (control group) were cultured in the same culture plates as those in the other groups. Mechanically stimulated and unstimulated NP cells were incubated at 37°C and 5% CO2 during stimulation.
The gels in the plates were transferred to sterile centrifuge tubes, and 100 µl glucanase each tube, provided in a 3D Life Dextran-PEG Hydrogel kit G90-1 (Cellendes GmbH, Reutlingen, Germany), was added to the tubes. Once the gels had dissolved, the suspended cells were harvested via centrifugation (500 × g, 6 min, room temperature).
Subconfluent NP cells (passage number <4) were equally divided into the siRNA group, the negative control group and the blank control group, and then were transferred to cell culture plates at a density of 5×105 cells/well. siRNA transfection was conducted using Lipofectamine iMax (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. The final siRNA (cat. no. sc-60384; Santa Cruz Biotechnology, Inc.) concentration was 100 nM. Cells in the control group were cultured in the same culture medium without siRNA. Negative control siRNA (cat. no. sc-37007; Santa Cruz Biotechnology, Inc.) was used to evaluate the off-target effects of RNAi and to verify the accuracy of gene-specific siRNA-dependent RNAi. Knockdown efficiency was detected at 48 h after transfection by reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blotting.
Subconfluent NP cells (passage number <4) were equally divided into the treatment groups and the control group and then were transferred to cell culture plates at a density of 5×105 cells/well. The cells were allowed to adhere for 24 h prior to treatment with rhCILP (10, 100 and 1,000 ng/ml). An untreated group served as the control group. The cells were incubated at 37°C and 5% CO2 for 72 h after treatment.
Total RNA was extracted using an RNeasy Mini Kit (Qiagen, Valencia, CA), and cDNA was reverse transcribed from 1 µg total RNA using an Omniscript Reverse Transcription kit (Qiagen, Inc., Valencia, CA, USA) according to the manufacturer's protocol. RT-qPCR was performed with a ViiA7 Real-Time PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) and a QuantiNova™ SYBR Green PCR kit (Qiagen, Inc.). Primers with the following sequences were used: Human GAPDH: F: 5′CCAGCAAGAGCACAAGAGGAAGAG3′, R: 5′GGTCTACATGGCAACTGTGAGGAG3′, human CILP: F: 5′AGCGGTGTACGGAAACTCG3′, R: 5′ACGGCACTCCCCTTCTTGT3′, human aggrecan: F: 5′TGAGGAGGGCTGGAACAAGTACC3′, R: 5′GGAGGTGGTAATTGCAGGGAACA3′ and human collagen II: F: 5′TTTCCCAGGTCAAGATGGTC3′, R: 5′TCACCTGGTTTTCCACCTTC3′.
qPCR reaction was performed in triplicate. The 20 ml reaction volume was applied. The reaction parameters were 95°C for 30 sec followed by 40 cycles of 95°C for 5 sec for template denaturation and 60°C for 34 sec for annealing and extension. The results are presented as a Cq value, which is the cycle number at which the amplified product was first detected. The mean Cq value was obtained from three repeated experiments. The expression levels of the target genes were normalized to that of the endogenous control (GAPDH). The relative target mRNA expression levels were calculated using the 2−ΔΔCq method (
Total protein was extracted using radioimmunoprecipitation assay lysis buffer (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) with Halt™ Protease/Phosphatase Inhibitor (Thermo Fisher Scientific, Inc.) at 4°C, with frequent agitation for 30 min. Cell lysates were cleared of insoluble debris via centrifugation at 12,000 × g for 30 min at 4°C. The amount of total protein was determined by bicinchoninic acid protein assay (Pierce; Thermo Fisher Scientific, Inc.). Equal amounts of protein (20 µg) were separated by 10% SDS-PAGE and transferred onto polyvinylidene difluoride membranes (Immobilon; EMD Millipore, Billerica, MA, USA), which were blocked with 5% milk for 1 h at 37°C. The filters were incubated overnight at 4°C with primary rabbit antibodies diluted 1:1,000 and then with horseradish peroxidase-conjugated secondary antibodies (cat. no. ZB-2301; Origene Technologies, Inc., Beijing, China) diluted 1:2,500 for 1 h at room temperature. Bands were detected using an enhanced chemiluminescence system (EMD Millipore) and scanned using an ImageQuant LAS4000 imaging system (GE Healthcare, Chicago, IL, USA). The optical density (OD) of the bands was measured using ImageJ software (National Institutes of Health, Bethesda, MD, USA).
GraphPad Prism 6 (GraphPad Software, Inc., La Jolla, CA, USA) and SPSS version 22.0 statistical software (IBM Corp., Armonk, NY, USA) were used to analyse and display the data of this study. Each condition was performed in triplicate, and the mean was determined. All of the results are presented as the mean ± standard deviation. Statistical comparisons were performed using a one-way analysis of variance, followed by Bonferroni's post hoc test. P<0.05 was considered to indicate a statistically significant difference.
Aggrecan and collagen II are the main components of the ECM, as well as traditional degenerative markers for IDD, and their expression levels decrease with ageing and degeneration. As presented in
The regulations of mechanical loading on the synthesis of ECM by NP cells was revealed previously; therefore, the present study aimed to investigate whether mechanical loading can regulate CILP expression. The expression of CILP demonstrated an opposite trend as that of the matrix genes in tensile loading; they decreased in a time-dependent manner following compressive loading (
The present study further investigated the effect of compressive loading on CILP expression. A compressive loading was applied at 1.0–2.5 MPa at 1 Hz, which is higher than that endured by NP cells in healthy IVDs in daily life. Consequently, compressive loading led to decreased aggrecan and collagen II expression, as well as markedly upregulated CILP expression, with peak expression detected in the 48-h group (P<0.05;
It is important to investigate whether excessive CILP expression by NP cells contributes to IDD. As previous studies have revealed the antagonism of CILP to TGF-β in rabbit NP cells (
To further verify the negative regulation of CILP on the synthesis of ECM, human NP cells were treated with various concentrations of rhCILP. The results in
The present study aimed to investigate the regulation of CILP by mechanical stress, and the association of CILP expression with the synthesis of aggrecan and collagen II, which are main components of the ECM that serve important roles in maintaining the normal structure and function of human IVDs. Consequently, to the best of our knowledge, the present study is the first to demonstrate that CILP expression is regulated by mechanical stress, and that its regulation varies with the type of mechanical stress. Furthermore, the results indicated that altered CILP expression has negative effects on the synthesis of aggrecan and collagen II.
Preliminary examinations of the correlation of CILP with IDD have been performed in previous studies. At the genetic level, CILP gene expression has been associated with IDD in Japanese and Finnish individuals (
IVDs are load-bearing structures that undergo various deformations in response to the spine load in daily life, and transfer the external mechanical load to resident cells in NP tissues (
However, there is a limitation to the present study study; the role of CILP in mechanical stress-mediated regulation of the ECM was not examined, of which the occurrence is implied by the findings of our study but is not directly demonstrated, which need further experiments to display. In conclusion, these results have suggested that CILP may be a potential therapeutic target for preventing loss of the ECM in IDD.
Not applicable.
The present study was funded by the National Natural Science Foundation of China (grant no. 81071497).
The analyzed data sets generated during the study are available from the corresponding author on reasonable request.
JH was involved in the conception and design of the study, collection and/or assembly of data, data analysis and interpretation, and manuscript writing. CF was involved in the collection and/or assembly of data, and data analysis and interpretation. KL and JS were involved in the collection and/or assembly of data, and provision of study materials and patients. TC was involved in the conception and design of the study, and the revision of the manuscript. YZ was involved in the conception and design of the study, and provided final approval of the manuscript. YP provided final approval of the manuscript, was involved in the conception and design of the study, and provided financial and administrative support.
Human IVDs were obtained with the approval of the Ethical Committee of Xinqiao Hospital (Chongqing, China) and with informed consent, in accordance with the Helsinki Declaration, from individuals undergoing surgery for IDD.
Not applicable.
The authors declare that they have no competing interests.
Expression of matrix genes in human nucleus pulposus cells under mechanical stress for various durations of stimulation. Reverse transcription-quantitative polymerase chain reaction analysis demonstrating the mRNA expression of aggrecan and collagen II under (A) tensile and (B) compressive loading. Representative western blot image for aggrecan under tensile (C) and collagen II under tensile is (E). Representative western blot image for aggrecan under compression is (D) and collagen II under tensile is (F). β-actin served as a loading control. Data are presented as the mean ± standard deviation. *P<0.05 vs. control.
CILP expression in human nucleus pulposus cells under mechanical stress for various durations of stimulation. Reverse transcription-quantitative polymerase chain reaction analysis demonstrating the mRNA expression of CILP under (A) tensile and (B) compressive loading. Representative western blot images and quantification of CILP protein expression levels under (C) tensile and (D) compressive loading. β-actin served as a loading control. Data are presented as the mean ± standard deviation. *P<0.05 vs. control. CILP, cartilage intermediate layer protein.
CILP expression is inhibited using siRNA. (A) RT-qPCR and (B) western blot analyses of mRNA and protein expression of CILP following knockdown of the CILP gene, respectively. (C) RT-qPCR and (D) western blot analyses of mRNA and protein expression of aggrecan following knockdown of the CILP gene, respectively. (E) RT-qPCR and (F) western blot analyses of mRNA and protein expression of collagen II following knockdown of the CILP gene, respectively. β-actin served as a loading control for western blotting. Data are presented as the mean ± standard deviation. *P<0.05 vs. control. CILP, cartilage intermediate layer protein; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; siRNA, small interfering RNA.
Expression of aggrecan and collagen II in nucleus pulposus cells treated with rhCILP at various concentrations (10, 100 and 1,000 ng/ml). (A) Reverse transcription-quantitative polymerase chain reaction analysis demonstrating the mRNA expression of aggrecan and collagen II in NP cells treated with rhCILP. Western blot analysis of (B) aggrecan and (C) collagen II protein expression levels following treatment with rhCILP. β-actin served as a loading control for western blotting. Data are presented as the mean ± standard deviation of three independent experiments. *P<0.05 vs. control. rhCILP, recombinant human cartilage intermediate layer protein.