Recent studies have indicated that autophagy contributes to tumorigenesis and participates in acquired chemotherapeutic resistance. The present study aimed to determine the function and underlying mechanism of cisplatin-induced autophagy in A549 human lung cancer cells. Autophagy was measured by LC3B-I/II conversion, LC3B puncta and autophagosomes formation. Apoptotic cell death was measured by caspase-3 activity, caspase-3 cleavage and LDH release. The transcriptional and expressional level of autophagy related proteins were measured by reverse transcription-quantitative polymerase chain reaction and western blot analysis. Beclin 1 and Atg 5 siRNA transfection was used to explore the function of cisplatin-induced autophagy. The results demonstrated that cisplatin induces apoptotic cell death in A549 cells and triggers an autophagic response, as indicated by increased microtubule-associated protein 1 light chain 3β (LC3B)-I/II conversion, increased LC3B puncta and autophagosome formation. Mechanisms underlying cisplatin-induced autophagic responses were also investigated. Cisplatin induced autophagy by upregulating the mRNA and protein expression levels of autophagy protein (Atg)5 and Beclin 1, whereas the mRNA and protein expression levels of serine/threonine-protein kinase ULK1, Atg3, Atg7, Atg12, and sequestosome-1 were not markedly upregulated. In addition, knockdown of Atg5 and Beclin 1 by small interfering RNA transfection impaired cisplatin-induced activation of autophagic responses, increased caspase-3 cleavage and inhibited cell viability. These findings suggested that disruption of autophagy via the inhibition of Atg5 and Beclin 1 may promote cisplatin-induced apoptotic cell death in A549 human lung cancer cells. In conclusion, the present study demonstrated that targeting autophagy may be used in the future for the treatment of lung cancer.
Lung cancer remains a leading cause of cancer-associated mortality worldwide, with an estimated 1.61 million new occurrences and 1.38 million fatalities occurring each year worldwide. In addition, the majority of patients are diagnosed at an advanced stage (
Cisplatin is a traditional first-line chemotherapy reagent (
Previous studies have suggested that certain chemotherapeutics induce both apoptosis and autophagy in tumor cells, and that the balance between autophagy and apoptosis may determine cell fate (
In the present study, the function and mechanism of cisplatin-induced autophagy were investigated. Beclin 1, serine/threonine-protein kinase ULK1 (ULK1), autophagy protein (Atg)5, Atg3, Atg7, Atg12 and sequestosome-1 (SQSTM1) transcription and expression were analyzed following cisplatin treatment. Knockdown of Atg5 and Beclin 1 by small interfering (si)RNA transfection was used to determine the association between cisplatin-induced apoptosis and autophagy. The results indicated that specific disruption of the autophagic response may be considered a rationale for the restoration of cisplatin sensitivity, and may provide a target for anti-lung cancer therapy.
Human lung cancer A549 cells (ATCC® CCL-185™) were purchased from American Type Culture Collection (Manassas, VA, USA) and cultured as previously described (
Total RNA was extracted by using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. CDNA was synthesized using a PrimeScript RT Reagent kit (Takara Bio, Inc., Otsu, Japan). The PCR reaction was performed with SYBR® Green Master Mix (Ambion; Thermo Fisher Scientific, Inc.) in an ABI 7500 RT-PCR System (Applied Biosystems; Thermo Fisher Scientific, Inc.). Primers were synthesized by Invitrogen (Thermo Fisher Scientific, Inc.; listed in
Cytoplasmic protein expression in cultured cells was detected using western blotting as previously described (
Beclin 1 and Atg5 siRNA were purchased from Santa Cruz Biotechnology, Inc. (Dallas, TX, USA). The recombinant lentiviral vectors, empty lentiviral vectors and secondary packaging plasmids were co-transfected into the 293T cells using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocols. The obtained Beclin 1 and Atg 5 siRNA particle solutions were designated as Lv-si8678 and Lv-si9474 and the Lv-control and were stored at −80°C until use. The sequences of Beclin1, Atg5 and negative control were: 5′-CAGTTTGGCACAATCAATA-3′, 5′-AUCCAUGAGUUUCCGAUUC-3′ and 5′-UUCUCCGAACGUGUCAGUT-3′, respectively. Transfection of cells with 100 nM siRNA was performed using Lipofectamine® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to a previously published method (
Cell viability was measured using the MTT assay according to the manufacturer's protocol (Promega Corp.). LDH release into the culture medium was measured using the LDH-dependent Cytotoxic Non-Radioactive Cytotoxicity Assay and caspase-3 activity was measured with a Caspase-3 Fluorometric Assay kit, both according to manufacturers' protocols.
For TEM, cells were embedded, sectioned, double stained and analyzed using a JEM-1200EX transmission electron microscope (JEOL, Ltd., Tokyo, Japan), as previously described (
Human lung cancer A549 cells (ATCC® CCL-185™) were treated with cisplatin (20 µM) for 96 h at 37°C in an atmosphere containing 5% CO2. LC3B puncta were measured using immunofluorescence, as previously described (
All values are presented as the means ± standard deviation (n=3). Quantitative data were analyzed using a Student's t test or two-way analysis of variance (ANOVA), with a Tukey post hoc test used following ANOVA, by using SPSS software (version 16.0; SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference.
Cleavage and activation of caspase-3 is necessary for the execution phase of intrinsic and extrinsic apoptotic signaling pathways (
Cellular stress responses, caused by factors including exposure to anticancer drugs, can trigger the autophagic response (
Autophagy occurred in A549 cells treated with cisplatin, as demonstrated by increased LC3B puncta (
The signaling pathways that mediate autophagic induction differ according to cell type and stimulus (
Subsequently, it was investigated whether autophagy resulted in cell death, or exerted protective effects following cisplatin treatment in A549 cells. Knockdown of Atg5 by siRNA transfection impaired cisplatin-induced Atg5 activation and therefore inhibited the activation of autophagy, and promoted caspase-3 cleavage (
A limited number of patients with lung cancer diagnosed at a metastatic stage survive >5 years. Cisplatin-based combination chemotherapy is used to extend the survival of patients with advanced lung cancer; however, the majority of patients relapse within 1 year, primarily due to acquired resistance (
Previous studies indicated reciprocal regulation between autophagy and apoptosis in tumor cell survival following chemotherapy (
A previous study demonstrated that upregulation of autophagy contributes to cisplatin resistance in human lung cancer cells (
Apoptosis and autophagy interact via crosstalk (
Beclin 1 initiates autophagy by forming a Beclin 1-phosphatidylinositol 3-kinase III/Vps34 complex. Previous studies demonstrated that decreased expression of Beclin 1 is associated with tumor progression in lung, colon and ovarian cancer (
Inhibition of autophagy promotes genomic instability, interferes with cellular differentiation, perturbs cellular metabolism, and prevents resistance to chemotherapy or radiotherapy (
In conclusion, the present study demonstrated that cisplatin can induce apoptosis and autophagy in human lung cancer cells
Not applicable.
The present study was supported by a grant from the National Natural Science Foundation of China (grant no. 81401631).
All data generated or analyzed during this study are included in this published article.
JC and LZ conceived and designed the experiments; HZ, WW and YL performed the experiments and contributed to molecular analysis; HY and H-hY analyzed the data; LZ wrote the manuscript.
Not applicable.
Not applicable.
The authors declare that they have no competing interests.
Cisplatin leads to apoptotic cell death in A549 cells. A549 cells were treated with cisplatin (20 µM) for the indicated time periods. (A) Cell viability and (B) LDH release were detected following cisplatin treatment. (C) Caspase-3 cleavage following cisplatin treatment was measured by western blotting. (D) Caspase-3 activity following cisplatin treatment. *P<0.05 vs. the CTR group (0 h). CTR, control; LDH, lactate dehydrogenase.
Cisplatin triggers the autophagic response in A549 cells. (A) A549 cells were treated with cisplatin (20 µM) and LC3B-I/II conversion was measured by western blotting. (B and C) A549 cells were treated with cisplatin (20 µM) for 96 h and LC3B puncta were measured using immunofluorescence. The blue is DAPI for DNA staining and the red is LC3B puncta staining for autophagosomes. (D and E) A549 cells were treated with cisplatin (20 µM) for 96 h and morphological alterations of double membrane-bound autophagosomes were assessed with transmission electron microscopy. The arrows indicate the formation of double membrane-bound autophagosomes. CTR, control; LC3B, microtubule-associated protein 1 light chain β.
Cisplatin-induced autophagic response involves upregulation of Atg5 and Beclin 1. (A) A549 cells were treated with cisplatin (20 µM) for 24 h, and Beclin 1, Atg5, ULK1, Atg3, Atg7, Atg12 and SQSTM1 transcription were analyzed by reverse transcription-quantitative polymerase chain reaction. A549 cells were treated with cisplatin (20 µM) at the indicated time points, and (B) Beclin 1 and Atg5, and (C) ULK1, Atg3, Atg7, Atg12 and SQSTM1 expression levels were measured by western blotting. *P<0.05 vs. the CTR group. Atg, autophagy protein; CTR, control; SQSTM1, sequestosome-1; ULK1, serine/threonine-protein kinase ULK1.
Inhibition of autophagy by Atg5 siRNA promotes cisplatin-induced apoptosis of A549 cells. A549 cells were transfected with 100 nM Atg5 siRNA for 16 h and were treated with cisplatin (20 µM) for 48 h. (A) Atg5 expression, caspase-3 cleavage and LC3B-I/II conversion was measured by western blotting. (B) Cell viability and (C) LDH release were measured using commercial kits. *P<0.05. Atg, autophagy protein; LC3B, microtubule-associated protein 1 light chain 3β; LDH, lactate dehydrogenase; NC, negative control; si/siRNA, small interfering RNA.
Inhibition of autophagy by Beclin 1 siRNA promotes cisplatin-induced apoptosis of A549 cells. A549 cells were transfected with 100 nM Beclin 1 siRNA for 16 h and treated with cisplatin (20 µM) for 48 h. (A) Beclin 1 expression, caspase-3 cleavage and LC3B-I/II conversion was measured by western blotting. (B) Cell viability and (C) LDH release were measured using commercial kits. *P<0.05. LC3B, microtubule-associated protein 1 light chain 3β; LDH, lactate dehydrogenase; NC, negative control; si/siRNA, small interfering RNA.
Primer pairs for quantitative polymerase chain reaction.
Primer sequence (5′→3′) | ||
---|---|---|
Target name | Forward | Reverse |
Beclin 1 | CAAGATCCTGGACCGTGTACA | TGGCACTTTCTGTGGACATCA |
Atg12 | TCTATGAGTGTTTTGGCAGTG | ATCACATCTGTTAAGTCTCTTGC |
Atg7 | AGGAGATTCAACCAGAGACC | GCACAAGCCCAAGAGAGG |
Atg5 | GGGAAGCAGAACCATACTATTTG | AAATGTACTGTGATGTTCCAAGG |
Atg3 | TCACAACACAGGTATTACAGG | TCACCGCCAGCATCAG |
ULK1 | CGCCTGTTCTACGAGAAGAAC | GAAGTCCATGCGGTCCTTGTG |
SQSTM1 | AAGCCGGGTGGGAATGTTG | GCTTGGCCCTTCGGATTCT |
GAPDH | GGGAAGCTTGTCATCAATGG | CATCGCCCCACTTGATTTTG |
Atg, autophagy protein; SQSTM1, sequestosome-1; ULK1, serine/threonine-protein kinase ULK1.