MSCs were purchased from Cyagen Biosciences, Inc. (Santa Clara, CA, USA; cat. no. MUCMX-01001). MSCs were cultured in DMEM/F12 (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) containing 20% fetal bovine serum (FBS; Hyclone; GE Healthcare Life Sciences, Logan, UT, USA), 100 U/ml penicillin and 100 µg/ml streptomycin (Gibco; Thermo Fisher Scientific, Inc.), in a humidified 5% CO₂ air incubator at 37°C. The MSCs were passaged when they reached 80–90% confluence at 1:3 and used at passage (P)3. 5-aza was purchased from Sigma-Aldrich (Merck KGaA, Darmstadt, Germany) and dissolved in dimethyl sulfoxide (Invitrogen; Thermo Fisher Scientific, Inc.). NIH/3T3 cells and 293T cells were purchased from the American Type Culture Collection (Manassas, VA, USA) and cultured in DMEM (Gibco; Thermo Fisher Scientific, Inc.) containing 10% FBS, 100 U/ml penicillin and 100 µg/ml streptomycin, in a humidified 5% CO₂ air incubator at 37°C. XAV-939 was purchased from Selleck Chemicals, Houston, TX, USA (cat. no. S1180), at working concentration of 10 nM.

MSCs at P3 were seeded into 6-well plates at a concentration of 5×10⁵ cells/well. At 24 h, MSCs were treated with 5-aza at a final concentration of 10 µM (day 0). The induction medium was changed following 24 h and cells were washed three times with PBS. Cells were cultured in DMEM/F12 containing 10% FBS for a further 6 (day 7) or 20 days (day 21).

Targetscan (http://www.targetscan.org/mamm_31/) and Pictar (http://www.pictar.org/) were used to determine potential target genes of miR-149.

miR-149 mimics and mimics control were designed and synthesized by Shanghai Genepharma Co., Ltd. Transfection of NIH/3T3 and 293T cells was performed using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. NIH/3T3 and 293T cells (2×10⁵) were seeded in 3.5-mm dishes overnight and transfected with 50 pmol miR-149 or mimic control the following day. The medium was changed 6 h post-transfection. The sequence of miR-149 mimics was: UCUGGCUCCGUGUCUUCACUCCC (+) and GAGUGAAGACACGGAGCCAGAUU (−). The sequence of mimics control was: UUCUUCGAACGUGUCACGUTT (+) and ACGUGACACGUUCGGAGAATT (−).

293T cells were seeded in 24-well plates at a density of 2×10⁴ cells/well. The 3′UTR of Dab2 containing the binding site of miR-149, was acquired by polymerase chain reaction (PCR) using MSCs and then cloned into pGL3 (Promega Corporation, Madison, WI, USA) with XbaI and XhoI restriction enzymes (New England BioLabs, Inc., Ipswich, MA, USA). PCR was performed with PrimeSTAR^®HS DNA Polymerase (Takara Bio, Inc., Otsu, Japan) using the following thermocycling conditions: 30 cycles of 98°C for 10 sec, 55°C for 15 sec and 72°C for 1 min. The primers used for PCR were as follows: Forward, 5′-GCCCTTTCGGAAATCCTTTTG-3′ and reverse 5′-CTGGGAGAGATCACCAGAAT-3′. A plasmid with a mutant miR-149 binding site was acquired using a site-directed mutagenesis kit (Stratagene; Agilent Technologies, Inc., Santa Clara, CA, USA). Plasmids were transfected into NIH cells using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. The luciferase activity assay was performed using a Promega Dual-Glo^® Luciferase Assay System (Promega Corporation), according to the manufacturer's protocol. The luminescence was measured using a Berthold LB9507 luminometer (Berthold Technologies GmbH & Co. KG, Bad Wildbad, Germany). Relative luciferase activity is presented as the ratio of firefly to Renilla luminescence.

Total RNA from MSCs was extracted using TRIzol reagent (Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. For miRNA detection, cDNAs were synthesized at 37°C for 60 min using the miRcute miRNA First-strand cDNA kit (Tiangen Biotech Co., Ltd., Beijing, China). For protein-coding genes, cDNAs were synthesized at 37°C for 60 min using the Quant Reverse Transcriptase kit (Tiangen Biotech Co., Ltd.). The expression level of miR-149 was detected using miRNA qPCR detection kits (Tiangen Biotech Co., Ltd.) according to the manufacturer's protocol, and was normalized to the expression level of small nuclear RNA RNU6B (U6). For protein-coding genes, data were normalized to the expression level of GAPDH. The relative expression levels of mRNA were calculated using the 2^−ΔΔCq method (16). qPCR was performed using the ABI 7500 system (Applied Biosystems; Thermo Fisher Scientific, Inc.) using SYBRGreen in a Super Real Pre Mix kit (Tiangen Biotech Co., Ltd.). The products were amplified using the following program: 94°C for 10 min, followed by 40 cycles of 94°C for 15 sec and 60°C for 30 sec. The sequences of the PCR primers are listed in Table I.

The lentiviruses overexpressing miR-149 and disabled homolog 2 (Dab2) were purchased from Shanghai Genepharma Co., Ltd. (Shanghai, China). Lentiviral infection was performed according to the manufacturer's protocol. MSCs (5×10⁵ cells/well) were seeded into 6-well plates and then incubated at 37°C with lentivirus overexpressing miR-149 or mock lentivirus (Shanghai Genepharma Co., Ltd.) at a multiplicity of infection (MOI) of 200 for 8 h. For MSCs overexpressing Dab2, the Dab2 lentivirus was added at an MOI of 100 1 day subsequent to the cells being infected with the lentivirus overexpressing miR-149, and the DMEM/F12 medium was changed at 24 h following incubation at 37°C. Gene expression was separately analyzed using RT-qPCR as previously described on days 3, 7 and 14 post-infection.

Cells were collected in ice-cold PBS 3 days post-infection or transfection, and total proteins were extracted with ice-cold radioimmunoprecipitation assay buffer with protease inhibitors (Roche Applied Science, Penzberg, Germany) and quantified with a bicinchoninic acid kit (Thermo Fisher Scientific, Inc.). Equal amounts of proteins (40 µg) were separated by 10% SDS-PAGE and transferred to 0.45-µm polyvinylidene fluoride membranes. The membranes were blocked with 5% fat-free milk in TBS containing 0.05% Tween-20 at room temperature for 1 h, and probed with the following primary antibodies overnight at 4°C: Anti-Dab2 (cat. no. ab137866; 1:1,000; Abcam, Cambridge, UK) and anti-β-actin (cat. no. ab227387; 1:3,000; Abcam). Membranes were subsequently washed three times with TBST and incubated with peroxidase-conjugated goat anti-rabbit IgG secondary antibodies (cat. no. 32460; 1:1,000; Invitrogen; Thermo Fisher Scientific, Inc.) for 1 h at room temperature. Signals were visualized using enhanced chemiluminescence reagents (Roche Applied Science). Dab2 antibodies were purchased from Cell Signaling Technology, Inc. (Danvers, MA, USA). Densitometric quantification was performed using ImageJ software (version 1.48; National Institutes of Health, Bethesda, MD, USA).

All experimental data are presented as the mean ± standard deviation. Statistical significance was determined by Student's t-test for two groups, or single factor analysis of variance followed by the Tukey's multiple comparisons test. Statistical analysis was performed using GraphPad Prism software (version 6.01; GraphPad Software Inc., La Jolla, CA, USA). All experiments were performed in triplicate. P<0.05 was considered to indicate a statistically significant difference.

The cardiac differentiation of mouse MSCs from bone marrow was induced with 5-aza, and the expression of miR-149 was detected with qPCR at different time points. It was identified that the expression level of miR-149 was upregulated with increasing treatment time of 5-aza (Fig. 1A). Therefore, it was hypothesized that miR-149 may serve a role in the cardiac differentiation of MSCs. To test this hypothesis, miR-149 was overexpressed in MSCs using a lentivirus and the expression of cardiac differentiation markers was detected using qPCR. Compared with the control group which was infected with mock lentivirus, miR-149 was overexpressed (Fig. 1B). The early markers of cardiac differentiation, Nkx2.5 and GATA-4, were upregulated when miR-149 was expressed for 3 days and the high level was maintained between 7 and 14 days (Fig. 1C and D). The expression of the late markers of cardiac differentiation, cTnI and CX43, continued to increase over time (Fig. 1E and F).

The present study aimed to elucidate the mechanism through which miR-149 may affect the cardiac differentiation of MSCs (Fig. 2). Targetscan and Pictar were used to analyze the potential target genes of miR-149, and it was identified that Dab2 may be regulated by miR-149 (17–19). First, the expression level of Dab2 was detected in 5-aza-induced MSCs, and it was observed that the expression of Dab2 was downregulated at the mRNA and protein level (Fig. 2A, C and F). Similarly, overexpressing miR-149 decreased the mRNA expression level of Dab2 at different time points (Fig. 2B). The protein expression level of Dab2 was detected following overexpression of miR-149 for 3 days in MSCs, and it was demonstrated that Dab2 was downregulated (Fig. 2D and G). Since Dab2 expression decreased during the process of cardiac differentiation, to rule out the influence of cardiac differentiation on Dab2, NIH 3T3 cells were transfected with miR-149 mimics. It was demonstrated that miR-149 was able to downregulate the protein expression level of Dab2 in NIH 3T3 cells (Fig. 2E and H). A dual luciferase assay was performed to detect whether Dab2 was the direct target of miR-149. miR-149 was able to decrease the relative luciferase activity of the wild type 3′UTR of Dab2, while it had no effects on the mutant 3′UTR of Dab2 (Fig. 2I and J).

To detect whether Dab2 mediates the cardiac differentiation of MSCs induced by miR-149, Dab2 was overexpression using a lentivirus in miR-149-overexpressing MSCs. Western blotting was performed to test the expression of Dab2 on the 7th day. As hypothesized, miR-149 decreased the expression of Dab2, while exogenous expression of Dab2 recovered the protein expression level (Fig. 3A and B). Cardiac differentiation markers were subsequently detected. Since CX43 was undetectable at baseline in MSCs (Fig. 1F), and on the 7th day all markers exhibited a detectable level, Nkx2.5, GATA4 and cTnI were detected on the 7th day. It was observed that miR-149 increased the expression of these genes, while overexpression of Dab2 was able to reverse the expression level of these genes almost to basal levels (Fig. 3C-E).

It has been reported that Dab2 may negatively regulate the canonical Wnt-β-catenin signaling pathway (20). The results of the present study demonstrated that overexpressing miR-149 increased the expression of Dab2-target Wnt pathway genes, including Axin2 and pterin-4 alpha-carbinolamine dehydratase 1 (Fig. 4A and B). In order to assess whether the effect of miR-149 depended on the Wnt/β-catenin signaling pathway, overexpressing miR-149 MSCs were treated with XAV-939, a Wnt/β-catenin signaling pathway inhibitor. It was identified that XAV-939 reversed the upregulation of cardiac differentiation markers induced by miR-149 (Fig. 4C-F), which suggested that miR-149 may promote the cardiac differentiation of MSCs via the Wnt/β-catenin signaling pathway.