Hypothermic machine perfusion (HMP) has been demonstrated to be a more effective method for preserving livers donated after circulatory death (DCD) than cold storage (CS); however, the underlying mechanisms remain unclear. The aim of the present study was to investigate the protective effects of HMP on rat DCD livers and the possible role of the nuclear factor erythroid 2-related factor 2 (Nrf2)/antioxidant response element (ARE) signaling pathway. A total of 18 adult male rats were randomly divided into three groups: Control, HMP and CS (n=6 per group). To simulate the conditions of DCD liver transplantation, rat livers in the CS and HMP groups were subjected to 30 min warm ischemia following cardiac arrest and were then preserved by CS or HMP for 3 h. Subsequently, after 1 h of isolated reperfusion, the extent of ischemia/reperfusion injury (IRI) and cellular functions were assessed. During reperfusion, intrahepatic resistance and bile production were measured, and the perfusion fluid was collected for liver enzyme analysis. The liver tissues were then harvested for the assessment of malondialdehyde (MDA) production, superoxide dismutase (SOD) activity, ATP levels, as well as for histological analysis, immunohistochemistry and a terminal deoxynucleotidyl transferase dUTP nick end labeling assay. Finally, the expression levels of the components associated with the Nrf2-ARE signaling pathway were analyzed via western blotting and reverse transcription-quantitative polymerase chain reaction. The results of the present study revealed that, compared with in the CS group, the HMP group exhibited higher levels of ATP, bile production and SOD activity, and improved histological results; however, lower levels of liver enzymes, apoptosis and MDA were detected. Additionally, the findings of the present study also suggested that the Nrf2-ARE signaling pathway may be activated by the steady laminar flow of HMP. In conclusion, HMP may attenuate ischemia-reperfusion injury to rat DCD livers via activation of the Nrf2-ARE signaling pathway.
Liver transplantation (LT) is the only effective means of treating end-stage liver disease; however, advances in liver transplantation are restricted by the shortage of donors (
Nuclear factor erythroid 2-related factor 2 (Nrf2) is a transcription factor associated with various intracellular signaling pathways and is a sensor of oxidative stress; thus, Nrf2 serves an important role in the main defense mechanisms induced by cellular oxidative stress (
The present study was conducted according to the Experimental Animal Regulations of the People's Republic of China and the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health and the Guide for the Care and Use of Laboratory Animals of the USA (
A total of 18 adult male Sprague-Dawley rats (age, 8 weeks; body weight, 250±10 g) were purchased from the Experimental Animal Culture Center of Hubei Centers for Disease Control (Hubei, China), and were maintained in the Animal Experimental Center of Zhongnan Hospital of Wuhan University (Wuhan, China). The rats were fed standard chow and water, and housed under standard experimental conditions (temperature: 20–25°C, humidity: 50–70%) under a 12 h light/dark cycle. To simulate DCD liver transplantation, 30 min of warm ischemia was conducted in livers (n=12, CS and HMP groups)
Then, in order to analyze reperfusion injury, livers were re-perfused in the isolated perfusion rat liver model for 1 h following graft preservation within the CS and HMP groups, and the same is true for the control group. For this purpose, the following experimental groups were selected: i) Control group (n=6), livers without warm ischemia and subsequent underwent 1 h reperfusion prior to sample collection; ii) CS group (n=6), DCD livers that underwent CS for 3 h, followed by 1 h reperfusion
Rats were anesthetized via an intraperitoneal injection of 1% sodium pentobarbital (30 mg/kg; Sinopharm Chemical Reagent Co., Ltd., Shanghai, China). A midline incision was conducted to provide entry into the abdominal cavity. The liver was carefully separated from the attached round ligament. Subsequently, the common bile duct was cannulated using a guided epidural tube (Jiangsu Changfeng Medical Industry, Co., Ltd. (Jiangsu, China) to collect bile during reperfusion. In the experimental groups, DCD was induced by hypoxia via an incision of the diaphragm without portal clamping prior to heparinization, as described below. The onset of
Following the modeling procedure, the liver was stored in the HTK solution at 0–4°C for 3 h to maintain a static state without any treatment. Following preservation, the CS group was simulated the period of rewarming for a 15 min and then connected to the IPRL, which is the reperfusion device used to assessment of IRI severity against livers (described below).
HMP and IPRL was performed as previously described (
The same perfusion device was used for HMP, as well as for the 1 h reperfusion period (n=12, CS and HMP groups). A detailed description of the HMP and IPRL system is given in as described in a previous study (
During reperfusion, which was performed for 1 h, intrahepatic resistance (IHR) was recorded by the portal pressure and portal flow and the perfusate was collected per 15 min. Intrahepatic resistance was calculated according to the following formula: Intrahepatic resistance (mmHg/ml/min/g liver)=portal pressure (10.3 mm Hg)/portal flow (ml/min/g liver) (
Frozen liver samples were lysed with 0.05 M Tris. HCl (Beijing Biotopped Science & Technology Co., Ltd., Being, China) extraction buffer on ice. The cell lysates were centrifuged at 4°C 12,000 × g for 10 min. The resulting cell lysates were used to assess the SOD activity and MDA content. To measure total SOD activity, a SOD kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) was employed according to the manufacturer's protocols. MDA content was assessed with an MDA assay kit (Nanjing Jiancheng Bioengineering Institute) based on the products of membrane lipid peroxidation, which are important indicators of oxidative damage during hepatic IRI.
The hepatic concentration of ATP served as an indicator of the energy status of grafts following 1 h of
Following reperfusion, about 0.25 g liver samples were fixed with 10% buffered formalin for 24 h at room temperature (pH=7.2; cat. no. G2161; Beijing Solarbio Science & Technology, Co., Ltd., Beijing, China), embedded in paraffin and cut into 5-µm sections for histological analysis via hematoxylin-eosin staining (H&E; hematoxylin staining for 5–15 min and eosin staining for 1–3 min; all performed at room temperature). Sections were analyzed under a confocal microscope (magnification, ×200; Nikon A1R/A1; Nikon Corporation, Tokyo, Japan) and images were obtained. A total of 6 fields of view per section were randomly selected for the assessment of liver damage. Numerical assessment of liver damage was conducted according to the histological criteria for assessment of liver damage (
Following reperfusion, a portion of the livers were fixed with 10% buffered formalin for 24 h at room temperature (pH=7.2; cat. no. G2161; Beijing Solarbio Science & Technology, Co., Ltd., Beijing, China), and then embedded in paraffin, sliced, dewaxed (Dewaxing was routinely performed at 60°C for 20 min, and immediately xylene 1–3 for 10 min, respectively. However certain sections prepared on the day could be treated at 60°C for 3–4 h), and hydrated conventionally using an ethanol gradient (from high to low). The tissues were cut into 4-µm sections and mounted on glass slides. After 30 min of blocking at room temperature with 5% bovine serum albumin (Beijing Solarbio Technology Co., Ltd., Beijing, China), the samples were incubated with rabbit anti-Nrf2 antibody (1:1,000; cat. no. 16396-1-AP; Wuhan Sanying Biotechnology, Wuhan, China) overnight at 4°C. The samples were then incubated for 1 h at room temperature with a horseradish peroxidase-conjugated goat anti-rabbit IgG (1:3,000; cat. no. GB23303; Wuhan Goodbio Technology Co., Ltd., Wuhan, China). Subsequently, the samples were incubated with 3,3′-diaminobenzidine chromogen (DAB; Maixin-Bio Ltd.) at room temperature for 5 min, and then blocked on a coverslip. Any brown and yellow staining was considered to indicate positive Nrf2 expression, as visualized under a light microscope (magnification, ×200, Leica DM2000; Leica Microsystems GmbH, Wetzlar, Germany). A total of 5 visual fields were randomly selected for analysis.
Total RNA was isolated from the liver specimens using TRIzol® reagent (Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the manufacturer's protocols. RNA was reverse transcribed into cDNA using the Easy Script One-Step gDNA Removal and cDNA Synthesis Super Mix (Beijing TransGen Biotech, Co., Ltd., Beijing, China). Total RNA (1 µg), Random primer (0.1 µg/µl), 2X ES Reaction Mix (10 µl), RI Enzyme Mix (1 µl), gDNA Remover (1 µl) were employed; the solution was made up to 20 µl with water (RNase-free). RT reactions were performed under the following conditions: 42°C for 1 h and 75°C for 5 min. The primers were synthesized by Shanghai ShineGene Molecular Biotech, Inc. (Shanghai, China;
Apoptosis was determined via a TUNEL assay (One-Step TUNEL Apoptosis assay kit, Beyotime Institute of Biotechnology, Haimen, China) according to the manufacturer's protocols. Briefly, 4-µm thick paraffin sections, which contained the liver tissues were deparaffinized and hydrated, then treated with proteinase K for 20 min and subsequently incubated with a mixture of fluorescent labeling solution and TdT enzyme at 37°C for 1 h in a humidified atmosphere. The samples were washed in 1XPBS and mounted in mounting media containing DAPI at room temperature for 10 min without the light. Blue ray was chosen as the exciting light, the wavelength is 420–485 nm. GFP was excited and emitted 515 nm green fluorescence. Liver cells, which expressed GFP emitted green fluorescent. The total hepatocytes and TUNEL-positive cells were detected in 4–5 randomly selected fields (magnification, ×200) for each liver section using a fluorescence microscope (Olympus X71; Olympus Corporation, Tokyo, Japan). The apoptotic rate was calculated according to the formula: Number of TUNEL positive cells/number total cells × % (
Prior to and following reperfusion, all collected liver tissues were rapidly dissected within 5 min and stored at −80°C for cryopreservation. In order to extract the total proteins, the liver tissue was thawed and homogenized in radioimmunoprecipitation assay buffer containing a protease inhibitor (cat. no. G2002; Wuhan Servicebio Co., Ltd., Wuhan, China) and then centrifuged at 20,000 × g for 10 min at 4°C. Following collection of the supernatants and measuring the total protein concentration, 30 mg protein, which was calculated by the bicinchoninic acid kit (cat. no. G2026; Wuhan Servicebio Co., Ltd., Wuhan, China) was separated by 10% SDS-PAGE and transferred to polyvinylidene difluoride membranes (EMD Millipore, Billerica, MA, USA). The membranes were blocked in 5% skimmed milk for 1 h at room temperature. The blots were then incubated in 4°C for 12 h with the following antibodies: Rabbit anti-Nrf2 antibody (1:1,000; cat. no. 16396-1-AP; Wuhan Sanying Biotechnology), rabbit anti-HO-1 antibody (1:2,000; cat. no. 27282-1-AP Wuhan Sanying Biotechnology), rabbit anti-NQO1 antibody (1:200; cat. no. bs-23407R Beijing Biosynthesis Biotechnology Co., Ltd., Beijing, China), rabbit anti-Toll-like receptor 4 (TLR4) antibody (cat. no. 19811-1-AP, 1:1,000; Wuhan Sanying Biotechnology), rabbit anti-B-cell lymphoma 2 (Bcl-2) antibody (1:1,000; cat. no. 10435-1-AP; Wuhan Sanying Biotechnology), rabbit anti-Bcl-2-associated X (Bax) antibody (1:1,000; cat. no. 60267-1-Ig; Wuhan Sanying Biotechnology) and anti-β-actin antibody (1:3,000; ProteinTech Group, Inc., Chicago, IL, USA). Following incubation for 1 h at room temperature with horseradish peroxidase-conjugated goat anti-rabbit IgG (1:3,000; cat. no. GB23303; Wuhan Goodbio Technology Co. Ltd., Wuhan, China), the proteins were detected using an enhanced chemiluminescence reagent (cat. no. G2020; Wuhan Servicebio Co., Ltd., Wuhan, China) followed by exposure to X-ray film. Quantification of protein bands was performed using ImageJ v1.42q software (National Institutes of Health, Bethesda, MA, USA).
All data were analyzed using SPSS 16.0 statistical software for Windows (SPSS, Inc., Chicago, IL, USA) by one-way analysis of variance with Tukey's post-hoc test. All results are presented as the mean ± standard deviation (n=6 for each experiment). P<0.05 was considered to indicate a statistically significant difference.
The activities of ALT and AST enzymes in the perfusate were used to assess the severity of IRI to DCD livers. In the present study, the levels of liver enzymes ALT and AST in the perfusate of the CS group increased significantly compared with in the control group (P<0.01;
The present study analyzed the typical biochemical markers of oxidative stress to further investigate the effects of HMP on the IRI livers. Oxidative stress has been considered to be an important factor leading to IRI. The SOD activities and expression levels of MDA of the tissues were presented in
Oxidative stress can also induce hepatic inflammation and apoptosis (
Nrf2 serves an important role in the main defense mechanisms induced by cellular oxidative stress (
Reperfusion injury due to toxic reactive oxygen species generated upon reintroduction of blood flow and oxygen supply to ischemic tissues is the main cause of DCD liver injury (
The results of the present study revealed that the expression levels of Nrf2, NQO-1 and HO-1 were all been significantly upregulated during reperfusion in both the CS and HMP groups (P<0.05;
Additionally, the mRNA expression levels of Nrf2, HO-1, NQO1, GST-1, and GCL in the liver were investigated via RT-qPCR (
Furthermore, previous studies have confirmed that Nrf2 may be activated in endothelial cells by steady laminar flow (
HMP has become a topic of interest in the past decade, with regards to maintaining the quality of liver grafts, particularly DCD livers (
Additionally, the present study demonstrated that, compared with the CS group, the HMP group revealed improved hepatocellular functions and overall tissue viability, as indicated by improved ATP and bile production, and lower ALT and AST levels. Bile production between the CS group and HMP group did not exhibit significant differences under the HMP condition, and this may have been due to the delivery of nutrients and oxygen via the portal vein rather than the hepatic artery, which is the only way oxygen is delivered in the physiological state (
Numerous mechanisms underlying IRI in the DCD liver grafts have been reported, including oxidative stress (
Oxidative stress may also induce hepatic inflammation and apoptosis (
Previous studies have suggested a role of Nrf2 in antioxidative and anti-apoptotic process functions in IRI (
Providing that reperfusion is the main cause of DCD liver injury, the present study also investigated the expression of proteins associated with the Nrf2-ARE signaling pathway prior to and following reperfusion to determine whether HMP may activate this signaling pathway. The protein expression levels of the Nrf2-ARE signaling pathway were significantly different prior to and following reperfusion. In addition, the higher end protein level quantification values of Nrf2 and NQO1 in the HMP group compared with the CS group following reperfusion indicated that the effect of HMP was more notable than CS treatment. In addition, the present study revealed that HMP may be able to reduce the extent of apoptosis and inflammation in accordance with alterations in Nrf2 expression. This indicated that the Nrf2-ARE signaling pathway may serve an important role in the molecular mechanism underlying the protective effects of HMP.
Furthermore, previous studies have confirmed that Nrf2 may be activated by steady laminar flow (
In the present study, the alterations of NRF2-ARE pathway by different storage method during simulated DCD liver transplantation were investigated. NRF2 is a key molecule in anti-oxidative stress (
The authors would like to thank the professors and students from Zhongnan Hospital of Wuhan University and Institute of Hepatobiliary Diseases of Wuhan University, who participated in this study.
The present study was supported by the National Natural Science Foundation of China (grant no. U1403222).
All data generated or analyzed during this study are included in this published article.
SX and QY contributed the central idea, analyzed most of the data, and wrote the initial draft of the paper. WH, XZ, ZZ, YX and YW contributed to refining the ideas. SX, QY, WH, XZ, ZT and SF carried out additional analyses and finalizing this paper.
The present study was conducted according to the Experimental Animal Regulations of the People's Republic of China and the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health, ensuring that all animals received humane care. The present study was approved by the Ethics Committee of Wuhan University (Wuhan, China).
Not applicable.
The authors declare that they have no competing interests.
Liver enzyme release, intrahepatic resistance and bile production during reperfusion. During reperfusion, intrahepatic resistance and bile production was continuously monitored. The perfusate was collected to measure liver enzyme release. Levels of (A) ALT and (B) AST in each group. (C) Intrahepatic resistance and (D) bile production in each group. #P<0.05, ##P<0.01 vs. the control group. **P<0.01 vs. the CS group. (n=6). ALT, alanine transaminase AST, aspartate amino transferase; CS, cold storage; HMP, hypothermic machine perfusion.
Liver histopathology. Extent of histological damage in the control, CS and HMP groups were quantified according to (A) congestion, (B) vacuolization and (C) necrosis score via (D) histological observation. Compared with the control and HMP groups, the CS group exhibited severe liver injury. ##P<0.01 vs. the control group. HMP significantly reduced the degree of injury compared with in the CS group. *P<0.05, **P<0.01 vs. the CS group. Magnification, ×200. CS, cold storage; HMP, hypothermic machine perfusion.
Effects of HMP on the index of inflammation and apoptosis. Following reperfusion, (A) SOD activity, (B) MDA expression levels and (C) ATP content in the liver tissues of each group were assessed using respective commercial kits. (D) Protein expression levels of Tlr4, Bcl-2 and Bax in the livers of each group were analyzed by western blotting. β-actin served as an internal control. Compared with in the CS group, the (E) Bcl-2/Bax ratio was significantly increased; however, the expression levels of (F) TLR4 protein were decreased. #P<0.05, ##P<0.01 vs. the control group; **P<0.01 vs. the CS group. Bcl-2, B-cell lymphoma-2; Bax, Bcl-2 associated X; CS, cold storage; DCD, donated after cardiac death; HMP, hypothermic machine perfusion; MDA, malondialdehyde; SOD, superoxide dismutase; TLR4, Toll like receptor 4.
Apoptosis of rat liver following reperfusion as determined by TUNEL assay. (A) The nuclei of liver cells were stained with 4′,6-diamidino-2-phenylindole and apoptosis was assessed by TUNEL staining. The percentage of apoptotic cells was determined by counting 4–5 microscopic fields per liver. Magnification, ×200. (B) Quantitative analysis of apoptosis. ##P<0.05, vs. the control group; **P<0.01, vs. the CS group. (n=6). CS, cold storage; HMP, hypothermic machine pressure; TUNEL, terminal deoxynucleotidyl-tranferase-mediated nick-end labeling.
Effect of HMP on Nrf2, HO-1 and NQO1 protein expression levels in donated after cardiac death rat liver models. (A and B) Following reperfusion, the protein expression levels of Nrf2, HO-1 and NQO1 in the livers of the control, CS and HMP groups were analyzed by western blotting. β-actin served as an internal control. #P<0.05, ##P<0.01 vs. the control group, *P<0.05, **P<0.01 vs. the CS group. (C and D) Western blotting and the quantitative analysis revealed the expression levels of the components associated with the Nrf2-ARE pathway in the livers of the CS and HMP groups prior to and following reperfusion. #P<0.05, ##P<0.01, the CS group vs. the BR CS group; and HMP group vs. the BR HMP group, respectively. AR, after reperfusion; BR, before reperfusion; CS, cold storage; HMP, hypothermic machine pressure; HO-1, heme oxygenase-1; NQO1, NAD(P)H:quinine oxidoreductase 1; Nrf2, nuclear factor erythroid 2-related factor 2.
Fold alterations in Nrf-2, HO-1, NQO1, GST-1, and GCL mRNA expression levels following reperfusion of rat livers. Reverse transcription-quantitative polymerase chain reaction revealed that the expression of antioxidant response element-containing genes (HO-1, NQO1, GST-1 and GCL) exhibited significant alterations between the CS and HMP groups. The quantification cycle values were quantified by the ratio of target relative to housekeeping gene β-actin and the differences were calculated by the 2−ΔΔCq method. #P<0.05, ##P<0.01 vs. the control group; *P<0.05, **P<0.01 vs. the CS group. CS, cold storage; GCL, glutamate cysteine ligase; GST-1, glutathione-S-transferase-1; HO-1, heme oxygenase-1; HMP, hypothermic machine pressure; NQO1, NADPH NAD(P)H:quinine oxidoreductase 1; Nrf2, nuclear factor erythroid 2-related factor 2.
Immunohistochemical localization of Nrf2 in the liver following reperfusion. (A) The pericentral region, which was stained with an antibody against Nrf2 in the control, CS and HMP groups. Scale bar=50 µm. Magnification, ×200. (B) The histochemical score of each group. #P<0.05, ##P<0.05, compared with the control group; **P<0.01, compared with the CS group. CS, cold storage; HMP, hypothermic machine pressure; Nrf2, nuclear factor erythroid 2-related factor 2.
Rat primer sequences used for reverse transcription-quantitative-polymerase chain reaction.
Gene | Sequence (5′-3′) |
---|---|
NRF2 | |
F | GAGATATACGCAGGAGAGGG |
R | CTTTTCAGAAGATGGAGGTTT |
HO-1 | |
F | GAAGGCTTTAAGCTGGTGATG |
R | GGCTGGTGTGTAAGGGATGG |
NQO1 | |
F | GGCTGGTTTGAGAGAGTGCT |
R | ACGTTCATGTCCCCGTGG |
GST-1 | |
F | CACAGAGACACAGCACAGC |
R | CCTTCCACCTCCAAAACAG |
GCL | |
F | GCAGCTCATTGGTTCATCT |
R | TCGTCCCTTCAAAGTCTTT |
β-actin | |
F | CCCTGGCTCCTAGCACCAT |
R | CACAGAGTACTTGCGCTCAGGA |
HO-1, heme oxygenase 1; GCL, glutamate cysteine ligase; GST-1, glutathione-S-transferase-1; NQO1, NAD(P)H:quinine oxidoreductase; NRF2, nuclear factor erythroid 2-related factor 2; F, forward; R, reverse.