MRSA41577 was provided by the Dalian Municipal Central Hospital (Dalian, Liaoning, China). The quality control strain, S. aureus ATCC25923 was provided by the Chinese Medical Culture Collection Center, National Center for Medical Culture Collections (Beijing, China; www.cmccb.org.cn/cmccbnew). Ciprofloxacin (CIP) and benzalkonium chloride (BAC; 40%) were purchased from Dalian Sanxing Wuzhou Chemical Co., Ltd. (Dalian, China; sanxingwuzhou.1688.com). Cefoxitin paper (30 µg/piece), reserpine and silybin were purchased from Novozymes Biotechnology Co., Ltd. (Shenyang, China). Primers and PCR reagents were purchased from Takara Biotechnology Co., Ltd. (Dalian, China). 2,3,5-Triphenyltetrazolium chloride (TTC) was purchased from Sangon Biotech Co., Ltd. (Shanghai, China).

Drug resistant strains of bacteria were detected using the cefoxitin paper method of the American Association of Clinical and Laboratory Standards Institute (CLSI2014) (10). S. aureus ATCC25923 was used as the quality control strain.

MRSA41577 cells were cultured in lysogeny broth (LB; Sangon Biotech Co., Ltd.) to the logarithmic phase and aliquots (3–6 ml) of the culture were then centrifuged at 3,000 × g for 5 min at 4°C, and the supernatant was discarded. Genomic DNA was extracted from the cell pellets according to previously described methods (11,12). Primers specific for the penicillin binding protein 2 (mecA), an MRSA-inherent gene, quinolone resistance protein NorA (norA), a surrogate for measuring resistance to fluoroquinolone antibiotics, and quaternary ammonium resistance proteins A/B (qacA/B) genes, representative of MRSA resistance to quarternary ammonium antibiotics (Table I), were designed according to the sequences published in GenBank (www.ncbi.nlm.nih.gov/genbank) using Primer Premier 5.0 (Premier Biosoft International, Palo Alto, CA, USA; www.premierbiosoft.com) software and reference documents. Premix Taq (Takara Taq Version 2.0 plus dye; Takara Biotechnology Co., Ltd.) was used for the PCR analysis. PCR was performed with the following thermocycling conditions: Initial denaturation at 94°C for 5 min, followed by 30 cycles of 94°C for 30 sec, 55°C 30 sec and 72°C for 45 sec, and a final extension at 72°C for 10 min. The amplified products were visualized by 1% agarose gel electrophoresis. The DNA samples were loaded onto a 1% agarose gel and visualized using ethidium bromide and a transilluminator.

The minimum inhibitory concentrations (MICs) of CIP and BAC were determined using a two-fold dilution method according to the National Committee for Clinical Laboratory Standards guidelines (13). A total of 100 µl MRSA41577 (10⁵ cfu/ml) was mixed with different concentrations of CIP (16, 32, 64 and 128 µg/ml) and BAC (0.5, 1, 2 and 4 µg/ml) in a 96-well plate and incubated at 37°C on a shaking plate (120 rpm) for 24 h. MRSA41577 cultured with 0 µg/ml CIP and BAC were used as a control. Following incubation, 20 µl 20% TTC was added to each sample and the plate was further incubated at 37°C in the dark for 4 h.

In order to elucidate the effect of CIP and BAC activity in the presence of silybin, various concentrations of silybin (16, 32, 64 and 128 µg/ml) were applied to 100 µl MRSA41577 (10⁵ cfu/ml) cells alone or in combination with either CIP (16, 32, 64 and 128 µg/ml) or BAC (0.5, 1, 2 and 4 µg/ml), in 96-well plates. The plates were incubated at 37°C for 24 h. Following incubation, 20 µl 20% TTC was added to each sample and the plate was further incubated at 37°C in the dark for 4 h. A blank control and a positive control were also prepared. The blank control was comprised of MRSA41577 cells cultured in culture media only without CIP, BAC or silybin treatment. Positive control MRSA4157 cells were cultured with reserpine only. The MIC of CIP to MRSA 41577 was 12 µg/ml. When the silybin was added, the MIC of CIP decreased notably, demonstrating that the sensitivity of MRSA41577 to CIP was improved. Each experiment was repeated three times.

Silybin, CIP and BAC were added alone or in combination (CIP or BAC with silybin) to a sample of 20 ml MRSA41577 (10⁵ cfu/ml). The final concentrations of silybin, CIP and BAC were 32, 16 and 0.24 µg/ml, respectively. The samples were incubated at 37°C on a shaking plate set at 120 rpm. The optical density values of the samples were continuously measured at 580 nm over a 12-h period. The control was comprised of MRSA41577 cells cultured in culture media only without CIP, BAC or silybin treatment. The experiment was repeated three times.

The double-plate method (14) was used to evaluate the effect of silybin on the efflux plump in MRSA. Briefly, four LB-agar plates were prepared, each containing 20 ml of the LB solid medium. To two of the plates, 200 µl of the MRSA41577 culture containing 1% agar was poured on top and allowed to solidify. To the other two plates, the same volume of MRSA41577 culture containing 1% agar was added, with the addition of either 32 µg/ml CIP or 2 µg/ml BAC. Following solidification, four holes, each with a diameter of 6 mm, were punched into the plate. Two of the holes were filled with 100 µl of a solution containing silybin (60 and 80 µg, respectively), while the other two holes were filled with 100 µl of a solution containing reserpine (60 and 80 µg, respectively). The plates were incubated at 37°C for 24 h, and the zone of bacteriostatic activity around each hole was then observed. A vernier caliper was used to accurately measure bacteriostatic circle, with the expected result that a higher concentration of the drug leads to an increased diameter of the bacteriostatic circle.

Following treatment with 32 µg/ml silybin for 16 h, 20 ml MRSA41577 (10⁵ cfu/ml) cells were harvested and washed with phosphate-buffered saline (PBS; pH 7.4). The cells were then resuspended in PBS (pH 7.4) and incubated at 37°C for 10 min. CIP was added to the cells to 20 µg/ml, which was followed by further incubation at 37°C. Aliquots (0.5 ml) of the cell suspension were removed at 3, 8, 15 and 20 min intervals during incubation. The samples were centrifuged (at 4°C and 3,000 × g for 5 min) and the cell pellets were each resuspended in 1 ml glycine-hydrochloric acid (0.1 mol/l; pH 3.0). All samples were incubated at 25°C for 2 h, followed by centrifugation (at 4°C and 3,000 × g for 5 min). The supernatants were removed for fluorescence analysis using emission and excitation wavelengths of 450 and 382 nm, respectively. The positive control in this experiment contained 20 µg/ml reserpine as an efflux pump inhibitor and the negative control contained no drugs.

20 ml MRSA41577 (10⁵ cfu/ml) was cultured in the absence or presence of 32 µg/ml silybin at 37°C to the logarithmic phase. Aliquots (4–6 ml) of the culture were then centrifuged at 10,000 × g and 4°C for 1 min to harvest the cells. Total RNA was extracted from the cells using the TRIzol method (Takara Biotechnology Co., Ltd.). RNA concentration was measured with a nucleic acid protein analysis instrument (Cole-Palmer Ltd., Stone, UK). The RNA was used as a template to synthesize the cDNAs of the norA and qacA/B genes by two-step reverse transcription, using RNA to cDNA EcoDry™ Premix (Oligo dT) (Takara Biotechnology Co., Ltd.). The 16S RNA was used as the internal reference gene. The temperature protocol was as follows: 42°C for 60 min, followed by heating at 70°C for 10 min. Amplification was performed using the following conditions: Initial denaturation at 95°C for 10 min, followed by 40 cycles of 95°C for 30 sec, 95°C for 5 sec and 53°C for 30 sec. At the end of amplification, the samples were then subjected to a further cycle of 95°C for 15 sec, 60°C for 30 sec and 95°C for 15 sec with continuous fluorescence monitoring using Thermal Cycler Dice Real Time System II (Takara Biotechnology Co., Ltd.). The primers used were: norA (F: 5′GAG TGC TGG TAT GGT AAT GCC3′; R: 5′CCCTGGTCCTAAAATGAATCC3′); qacA/B (F: 5′TTGAGCAATTTTCATGGCACTC3′; R: 5′CCCACGAGTGAGACTTTTCTTTT3′); and 16S RNA (F: 5′GCTCGTGTCGTGAGATGTTGG3′; R: 5′TTTCGCTGCCCTTTGTATTGT3′). The relative expression levels of norA and qacA/B genes were calculated using the equation 2^−ΔΔCq (15), where ΔCq was measured by subtracting the Cq of the 16S RNA value from the Cq value of norA or qacA/B. The experiment was repeated three times.

MRSA41577 cells were cultured at 37°C to the logarithmic phase and aliquots (3–4 ml) of the culture were centrifuged at 3,000 × g for 1 min at 4°C to harvest the cells for plasmid DNA extraction, according to the method described by Chen et al (16). The extracted plasmid DNA was subjected to 1% agarose gel electrophoresis and visualized using ethidium bromide and a transilluminator.

MRSA41577 cells were cultured at 37°C in LB medium containing 32 µg/ml silybin to the logarithmic phase. A total of 200 µl cell suspension (10⁹ cfu/ml) was spread onto an LB agar plate and then incubated at 37°C for 24 h. Single colonies (~300) were randomly picked and replica-plated onto new plates containing 0 or 2 µg/ml BAC. The two plates were incubated at 37°C for 24 h and the number of colonies observed on the plates were counted to calculate the plasmid elimination rate. Plasmid elimination rate (%)=(A/B) × 100; where A was the number of colonies observed on the plate containing common culture medium without antibiotics, but, could not grow in the selective medium containing antibiotics and B is the number of colonies that were observed on the plate containing common culture medium without antibiotics (17).

Statistical analysis was performed using SPSS software version 13.0 (SPSS, Inc., Chicago, IL, USA). Data are expressed as the mean ± standard deviation and were analyzed by one-way analysis of variance followed by least significant difference post hoc test (equal variances). P<0.05 was considered to indicate a statistically significant difference.

The quality control strain ATCC25923 was sensitive to cefoxitin, however, MRSA41577 was resistant to it. The diameter of the inhibition zone of ATCC25923 was 29 mm (Fig. 2). According to the CLSI2014 criteria, bacterial strains that produce a bacteriostatic zone of <21 mm are considered to be resistant MRSA strains, while strains that produce a bacteriostatic zone of >22 mm are regarded as sensitive strains. Thus, the MRSA41577 strain used in the present study was regarded as a MRSA resistant strain.

The mecA gene has been become a molecular index for detecting MRSA, and the norA and qacA/B genes are considered to be significant contributors to antibiotic resistance (18). The mecA gene was detected in MRSA41577 cells (Fig. 3A), further confirming that it was a MDR bacterial strain. In addition, the efflux pump genes norA (Fig. 3B) and qacA/B (Fig. 3C) were also detected in these cells.

Silybin had no bacteriostatic effect on MRSA41577 at the range of concentrations tested (16 to 128 µg/ml). The MICs of CIP and BAC were 128 and 4 µg/ml, respectively. When silybin was combined with CIP and BAC, the resulting mixture reduced the MIC of CIP and BAC. Following treatment with 32 µg/ml silybin, the MIC of CIP was reduced by 4-fold and the MIC of BAC was reduced by 2-fold when compared with treatment without silybin (Table II). When these drugs were used individually, the growth curves obtained for MRSA41577 were comparable to that produced by the control (Fig. 4). However, when silybin was used in combination with BAC or CIP, growth was markedly inhibited when compared to the control; treatment with silybin+CIP was more inhibitory than silybin+BAC. These results indicated that silybin may be an efflux pump inhibitor of the MRSA41577 efflux pump system.

The results of the double-plate assay suggested that in the control group (no CIP and BAC in the culture), silybin had no effect on MRSA41577. However, when CIP (Fig. 5A) and BAC (Fig. 5B) were included in the culture, positive bacteriostatic zones were observed, indicating that silybin may inhibit MRSA41577. In addition, its inhibitory effect was consistent with the positive control reserpine.

According to the CIP standard curve, a linear relationship between fluorescence intensity and CIP concentration was observed for the range of 0.2 to 20 µg/ml, with linear regression y=4.8418×+2.7472, where R²=0.9974. When compared with the control, MRSA41577 treated with silybin exhibited increased fluorescence, which also increased over time, which indicated that the concentration of CIP entering the bacteria increased. After 15 min, the level of was CIP increased by ~70% in the silybin-treated culture compared with those treated with 32 µg/ml CIP only (P<0.01; Fig. 6). This further illustrated that silybin inhibits the release of CIP out of cells via the efflux pump, indicating that silybin may function as a efflux pump inhibitor.

Silybin appeared to significantly inhibit the expression of the efflux gene norA (P<0.05). Following 16 h of treatment, silybin (32 µg/ml) reduced the expression of norA by 36% and that of qacA/B by 49% compared with the respective controls (P<0.05; Fig. 7).

Three different DNA plasmids were detected in MRSA41577; a major one of ~23,130 bp, and two minor ones of ~500 and 100 bp, respectively (Fig. 8). The identification of these plasmids in MRSA41577 suggested that the qacA/B gene may be carried by these plasmids, as it is known to be a plasmid-encoded gene.

The plasmid elimination experiment demonstrated that 300 MRSA41577 single colonies were able to grow on plates without BAC, however, when grown with BAC only 29 single colonies were produced. The plasmid elimination rate reached 90%.