HUVECs and 293T cells were purchased from the Shanghai Institute for Biological Sciences, Chinese Academy of Sciences (Shanghai, China). According to the supplier's protocols, cells were cultured in Dulbecco's modified Eagle's medium (Hyclone; GE Healthcare Life Sciences, Logan, UT, USA) supplemented with 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) and 1% antimycotic-antibiotic solution (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) in a humidified atmosphere of 5% CO₂ at 37°C.

miR-155 mimics, inhibitor and negative controls (NCs) were purchased from Guangzhou RiboBio Co., Ltd. (Guangzhou, China). Cells were transfected with 50 nmol/l miR-155 mimics, miR-155 inhibitor or NCs for 6 h, using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol; complete medium containing FBS was then added for 24 h. In order to induce autophagy, HUVECs were stimulated with 100 µg/ml ox-LDL (Guangzhou Yiyuan Biotech Co., Ltd., Guangzhou, China) for 12 h. They were subsequently treated with 0.5 µmol/l bafilomycin A1 for 12 h at 37°C to block cytolysosome and lysosome fusion. HUVECs were divided into seven experimental groups: i) Control; ii) ox-LDL + miR-155 inhibitor; iii) ox-LDL + miR-155 mimic; iv) ox-LDL + bafilomycin A1; v) ox-LDL; vi) ox-LDL + miR-155 inhibitor-NC; and vii) ox-LDL + miR-155 mimic-NC.

HUVECs were plated in 10 cm petri dishes in a humidified atmosphere of 5% CO₂ at 37°C for 24 h. Cells at 70–80% confluence were used for experiments. The cells were trypsinized, washed once with PBS and harvested by centrifugation at 20,000 × g at 4°C for 10 min. The cell pellet (0.5 cm) was fixed in 10 ml ice-cold 2.5% glutaraldehyde in 0.1M sodium cacodylate buffer (pH 7.2) at 4°C overnight. Samples were sent to the laboratory of Qingdao University (Qingdao, China), and subsequently post-fixed in PBS with 1% osmium tetroxide for 1 h at 4°C, followed by dehydration in graded ethanol (70% for 20 min, 96% for 20 min, and 100% ethanol for 20 min twice) and propylene oxide. Cells were embedded in epoxy resin. Sectioned grids were stained with 2% uranyl acetate in 50% methanol for 10 min and lead citrate for 7 min at 4°C. Images were captured on a transmission electron microscope (JEM-1220; JEOL, Ltd., Tokyo, Japan) at an accelerating voltage of 80 kV and a magnification of ×40,000. A total of 10 field of view were randomly selected to observe autophagosomes in each group.

Cells (3×10⁴ cells per well) were cultured on glass coverslips in a 24-well culture plate covered with cell culture medium (DMEM with 10% FBS and 1% antimycotic-antibiotic solution) in a humidified atmosphere of 5% CO₂ at 37°C. Next, the cells on coverslips were fixed using 4% paraformaldehyde (Beijing Solarbio Science & Technology Co., Ltd.) for 15 min at 4°C and permeabilized with 1% Triton X-100 (Beijing Solarbio Science & Technology Co., Ltd.) for 10 min. Following washing of the coverslips, cells were blocked with 3% bovine serum albumin (BSA; Beyotime Institute of Biotechnology, Haimen, China) to prevent non-specific antibody binding and incubated at 4°C overnight with 1% BSA in PBS 0.5% Tween containing antibodies against microtubule-associated protein light chain 3 (LC3; cat. no. 3868S; 1:100; Cell Signaling Technology, Inc., Danvers, MA, USA). Cells were subsequently washed twice with PBS 0.5% Tween and incubated with fluorescein isothiocyanate-conjugated goat anti-rabbit IgG secondary antibodies (1:200; BIOSS, Beijing, China) in 1% BSA in the dark for 1 h at 37°C. The cells were washed in PBS and nuclei were stained with 10 µg/ml of DAPI (Shanghai Yeasen Biotechnology Co., Ltd., Shanghai, China) for 5 min in the dark. Cells were washed again and antifade mounting medium (Beyotime institute of Biotechnology) was added prior to mounting on glass slides for examination. Images were acquired using a laser-scanning confocal imaging system (magnification, ×25,000; TCS SP5; Leica Microsystems GmbH, Wetzlar, Germany).

Protein extracts were prepared from cells using radioimmunoprecipitation assay lysis buffer containing protease and phosphatase inhibitors (Beyotime Institute of Biotechnology). Following centrifugation at 4°C for 5 min at 30,000 × g the supernatant was collected and protein concentrations in the lysates were measured using a bicinchoninic acid protein assay kit (Beyotime Institute of Biotechnology). Total protein (50 mg) was separated by 10% SDS-PAGE and transferred onto polyvinylidene difluoride membranes, which were blocked with 5% skimmed milk powder in Tris-buffered saline with 0.1% Tween 20 (Beijing Solarbio Science & Technology Co., Ltd.) for 2 h at 4°C. The membranes were incubated with the following primary antibodies at 4°C overnight: Rabbit anti-LC3B (cat. no. ab48394; Abcam), rabbit anti-PI3K (cat. no. 4257; Cell Signaling Technology, Inc.), rabbit anti-phosphorylated (p)-PI3K (cat. no. 5538; Cell Signaling Technology, Inc.), rabbit anti-Rheb (cat. no. 13879; Cell Signaling Technology, Inc.), rabbit anti-Akt (cat. no. 4691S; Cell Signaling Technology, Inc.), rabbit anti-p-Akt (cat. no. 4060; Cell Signaling Technology, Inc.), rabbit anti-70 kDa ribosomal protein S6 kinase 1 (p70s6k; cat. no. 2708; Cell Signaling Technology, Inc.), rabbit anti-p-p70s6k (cat. no. ab1314362; Abcam) and rabbit anti-GAPDH (cat. no. CW0101; Beijing ComWin Biotech Co., Ltd., Beijing, China) antibodies. All primary antibodies were diluted to 1:500. Following washing with 0.1% TBST, membranes were treated with a horseradish peroxidase-conjugated goat anti-rabbit immunoglobulin G secondary antibody (cat. no. CW0101, 1:2,000; Beijing ComWin Biotech Co., Ltd.) for 2 h at 37°C. The signals were detected with enhanced chemiluminescence kit (EMD Millipore, Billerica, MA, USA). The relative densities of LC3, PI3K, p-PI3K, Rheb, Akt, p-Akt, p70s6k and p-p70s6k were determined by normalization to the density value of GAPDH in the same blot. Relative band intensity was analyzed using ImageJ 1.8.0 software (National Institutes of Health, Bethesda, MD, USA).

Total RNA was extracted from cells using TRIzol reagent (Invitrogen; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. miRNA was reverse transcribed into cDNA (25°C for 10 min, 42°C for 50 min, followed by 70°C for 15 min) using an miRNA cDNA synthesis kit (Beijing Aidiab Biotechnologies Co., Ltd., Beijing, China) and qPCR was performed with a SYBR Green miRNA qPCR assay kit (Beijing ComWin Biotech Co., Ltd., Beijing, China). mRNA was reverse transcribed (25°C for 10 min, 42°C for 50 min, followed by 70°C for 15 min) using a PrimeScript™ RT reagent kit (Beijing Aidiab Biotechnologies Co., Ltd.,) and qPCR was performed with SYBR^® Premix Ex Taq™ (Takara Bio, Inc., Otsu, Japan). The housekeeping gene GAPDH was used as an internal control; the internal control employed for the normalization of miRNA expression levels was U6 (Sangon Biotech Co., Ltd. Shanghai, China). PI3K, Rheb and GAPDH primers were purchased from Sangon Biotech Co., Ltd. The mature miR-155 primer (qRT-PCR Primer Set, cat. no. 132, Sanger Registry ID Human has-miR-155, Sanger Accession no. Human MIMAT0000646, mature sequence UUAAUGCUAAUCGUGAUAGGGGU) was purchased from Takara Bio, Inc. The sequences of each specific primer were as follows: PI3K forward, 5′-GACTTTGCGACAAGACTGCC-3′ and reverse, 5′-AATCTGAAGCAGCGCCTGAA-3′; Rheb forward, 5′-AGCTTTGGCAGAATCTTGGA-3′ and reverse, 5′-CACATCACCGAGCATGAAGA-3′; GAPDH forward, 5′-AGAAGGCTGGGGCTCATTTG-3′ and reverse, 5′-AGAAGGCTGGGGCTCATTTG-3; U6 forward, 5′-CTCGCTTCGGCAGCACA-3′ and reverse, 5′-AACGCTTCACGAATTTGCGT-3′. A total of three independent experiments were performed under the same experimental conditions. All reactions ran at 95°C for 2 min, followed by 40 cycles at 94°C for 15 sec and 60°C for 1 min and extension 75°C for 30 sec. The relative mRNA and miRNA expression levels were quantified by calculating the ΔCq value: Cq value (target gene)-Cq value (housekeeping gene). The relative expression levels were calculated using the 2-∆∆Cq method (17).

The present study used bioinformatics tools to predict target genes for miR-155, including miRanda (omictools.com/miranda-tool), TargetScan (www.targetscan.org), miRBase (www.mirbase.org) and PicTar (pictar.mdc-berlin.de). miR-155 was determined to be closely associated with the PI3K/Akt/mTOR signaling pathway. The gene PIK3CA, encoding the p110 catalytic protein subunit of PI3K, as well as Rheb, were identified as potential target genes of miR-155.

Human miR-155-5p overexpression plasmid, negative control plasmid, PIK3CA, and Rheb 3′-untranslated region (UTR) reporter plasmids were designed and purchased from Shanghai Genechem Co., Ltd. (Shanghai, China). PIK3CA-wild type (wt), PIK3CA-mutant (mut), Rheb-wt and Rheb-mut reporters were successfully constructed using molecular cloning technology. For the construction of the PIK3CA- and Rheb-expressing plasmid, the 3′-UTRs of PIK3CA and Rheb, which contained the putative miR-155 binding sites, were amplified using PCR (conducted by Shanghai Genechem Co., Ltd.) and the product inserted into pGL3 luciferase plasmids at the NotI and XhoI restriction sites. The reporter vector was termed wt. A point mutation (mut) was incorporated into the binding sites of the 3′-UTR in the PIK3CA and Rheb genes to generate a mutant reporter vector. 293T cells grown in 24-well plates were co-transfected using Lipofectamine 2000 with 10 nM negative controls or miR-155 mimics, and 500 ng dual-luciferase reporter plasmid per well, which was either PIK3CA-wt, PIK3CA-mut, Rheb-wt, Rheb-mut or empty vector. Renilla relative luciferase activity was measured 48 h post-transfection using a dual-luciferase reporter assay system according to the manufacturer's protocol (Promega Corporation, Madison, WI, USA). Each transfection was repeated three times.

Statistical analyses were performed with SPSS software version 16.0 (SPSS, Inc., Chicago, IL, USA). Differences between groups were assessed using one-way analysis of variance followed by Fisher's Least Significant Difference for multiple comparisons. The results were expressed as the mean ± standard deviation of three independent experiments. P<0.05 was considered to indicate a statistically significant difference.

To explore the role of miR-155 in autophagy, the present study used TEM to evaluate autophagosome and autolysosome accumulation. The TEM results demonstrated that the average number of autophagic vacuoles and autolysosomes in the control group was 2–3. It was observed that inhibition of the expression of miR-155 with miR-155 inhibitors resulted in the suppressed formation of autophagic vacuoles and autolysosomes, compared with the control mimic (NC) group. The average number of autophagic vacuoles and autolysosomes was 0–1 in the miR-155 inhibitor group. In the miR-155 mimic groups, cells displayed a higher number of autolysosomes and autophagic vesicles than the NC group, and the average number of autolysosomes and autophagic vacuoles was 5–7 (Fig. 1A). Following this, laser confocal microscopy was performed to detect LC3 puncta accumulation in ox-LDL-stimulated HUVECs. LC3 puncta appear in the cytoplasm and reflect the recruitment of LC3 proteins to autophagosomes (18). The fluorescence intensity of LC3 was reduced in miR-155 inhibitor-transfected cells, compared with NC cells. Conversely, transfection of HUVECs with miR-155 mimics induced an increase in the fluorescence intensity, compared with NC cells (Fig. 1B). To further confirm the promotion of autophagy by miR-155, the conversion of LC3-I to LC3-II (via the ratio of LCII to LC1) was examined through western blotting (Fig. 2A). It was observed that LC3-II expression levels were higher in the miR-155-mimic group compared with the control group, and that these autophagic markers were inhibited in HUVECs transfected with miR-155-inhibitors, compared with the control group (Fig. 2B), which was in accordance with results from electron microscopy and confocal microscopy. Lysomotropic bafilomycin A1 prevents lysosome and autophagosome fusion, and is often used for measurement of autophagic flux (19). When cells were treated with bafilomycin A1, autophagic activity was significantly increased compared with the ox-LDL group, and the average number of autolysosomes and autophagic vacuoles was 5–6 (Figs. 1 and 2). Taken together, these results suggested that miR-155 efficiently promoted autophagy in vascular endothelial cells.

The efficiency of miR-155 transfection in HUVECs was examined. RT-qPCR data revealed that miR-155 expression was significantly increased in the miR-155 mimic group, compared with the corresponding negative control group. Furthermore, miR-155 levels were significantly decreased compared with the corresponding negative control group following miR-155 inhibitor transfection (Fig. 3A). The results were repeatedly verified as stable following the exclusion of interference from other factors under the same conditions, such as the transfection reagent and transfection conditions. Our previous study achieved similar results (16). To investigate the role of the PI3K/Akt/mTOR signaling pathway and miR-155 in HUVECs, RT-qPCR and western blotting was performed to detect the mRNA and protein expression levels of key members of the PI3K/Akt/mTOR signaling pathway. The results demonstrated that overexpression of miR-155 inhibited Akt (Fig. 3B) and p70s6k (Fig. 3C) mRNA expression, compared with the controls. Furthermore, Akt and p70s6k mRNA expression significantly increased in the miR-155 inhibitor group. In addition, western blot analysis was performed to determine the relative protein expression of total/p-Akt and total/p-p70s6k (Fig. 3D). Densitometry confirmed that similar, significant effects were observed in the levels of Akt (Fig. 3E) and p70s6k (Fig. 3F) activity in response to miR-155 mimics and inhibitors. Therefore, the data verified that miR-155 promoted autophagy by negatively regulating the expression PI3K/Akt/mTOR signaling pathway proteins in HUVECs.

An association between miR-155 and the PI3K/Akt/mTOR signaling pathway was demonstrated in the present study; however, the present study aimed to elucidate the mechanism underlying this. Bioinformatics analyses were performed to predict potential target genes for miR-155. PIK3CA and Rheb were identified due to the existence of the evolutionarily conserved miR-155 binding site in the 3′-UTR of these genes (Fig. 4A). In order to confirm these genes as targets of miR-155, a luciferase reporter plasmid was constructed that contained the human PIK3CA and Rheb mRNA 3′-UTR binding sites, downstream of the firefly luciferase reporter gene (the reporter vector was named wild-type). A point mutation was also incorporated into the PIK3CA and Rheb gene 3′-UTR binding sites to generate a mutant reporter vector.

miR-155 mimic or NC was transfected with 500 ng wild-type or mutated reporter plasmids. Co-expression of PIK3CA or Rheb 3′-UTR constructs with miR-155 mimics was established in 293 cells. Luciferase activity was determined 24 h post-transfection. The luciferase reporter assay indicated that miR-155 significantly reduced the relative luciferase activity of the reporter vector containing the wild-type 3′-UTR of PIK3CA (Fig. 4B) or Rheb (Fig. 4C), compared with the negative control. Conversely, miR-155 did not significantly inhibit luciferase activity in cells expressing mutant PIK3CA and Rheb 3′-UTR, or empty vector. These results suggested that miR-155 directly bound to the 3′-UTR of PIK3CA and Rheb, and inhibited luciferase activity. Therefore, PIK3CA and Rheb were verified as target genes of miR-155.

miR-155 expression was subsequently detected in cells stimulated with ox-LDL. Ox-LDL treatment alone significantly increased miR-155 expression compared with the control. In addition, treatment with ox-LDL and miR-155 mimics resulted in significantly higher miR-155 expression, compared with the ox-LDL and miR-155 mimic NC group (Fig. 5A). In addition, the levels of PI3K (Fig. 5B) and Rheb (Fig. 5C) mRNA were significantly downregulated in HUVECs transfected with miR-155 mimics compared with the corresponding NC group. However, in cells stimulated with ox-LDL, miR-155 inhibitor transfection increased PI3K and Rheb mRNA expression to levels comparable with the control group. Furthermore, western blot analysis was performed to detect the protein expression of Rheb, PI3K and p-PI3K (Fig. 5D). Transfection of miR-155 mimics suppressed the protein levels of p-PI3K (Fig. 5E) and Rheb (Fig. 5F) compared with the control group; however, miR-155 inhibitors did not result in a significant reduction in protein levels. In addition, total PI3K expression remained unchanged. The different effects observed at the mRNA and proteins were thought to be due to two potential reasons. It may be a dynamic effect; one mRNA converts to protein more efficiently within a certain time, so protein downregulation is not significant. On the other hand, this may be due to a negative feedback loop in the cell. In this process, following miRNA-mediated protein downregulation, the cell may increase mRNA production due to the cell requirements, or other regulatory processes (20–25). These results verified that miR-155 suppressed the expression of PI3K and Rheb in HUVECs. Therefore, it is possible that miR-155 regulated autophagy by targeting PI3K and Rheb in atherosclerosis.