The present study complied with the Guidelines for the Care and Use of Laboratory Animals published by the US National Institutes of Health (19). All experimental procedures were approved by the Animal Ethics Committee and Research Ethics Committee of Yunnan Province, China (license no. KM3476-821), and Kunming Medical University (Kunming, China; license no. KY976222-m23).

The present study strictly abided by the guidelines of Kunming Medical University for the care and use of laboratory animals. A total of 36 healthy Japanese white rabbits (weight, 2.2–2.5 kg) of either sex (1:1 male:female) were purchased from the Experimental Animal Center of Kunming Medical University [Animal Certificate of Conformity no. 0020946; animal license no. scxk (Yunnan) 2011–0004]. The rabbits were randomly divided into six groups (n=6 per group): Sham-operated group (group S), OLV group (group O), OLV+SVF inhalation group (group OF), club cells exfoliated + sham-operated group (group NA), club cells exfoliated + OLV group (group NAO) and club cells exfoliated + OLV + sevoflurane group (group NAOF).

In group S, the trachea, left common carotid artery and right external jugular vein were exposed, followed by placing an endotracheal tube (inner diameter of 2.0 mm) via tracheotomy between tracheal rings 2 and 3, without further surgery. OLV was achieved by placing the tracheotomy tube into the right main bronchus. Mechanical ventilation was performed by OLV for 2 h followed by two-lung ventilation (TLV) for 1 h with an identical ventilator (Aestiva/5 7900; Datex Ohmeda Inc.; GE Healthcare Bio-Sciences, Pittsburgh, PA, USA). The setting parameters were as for groups that received OLV were as follows: Inspired oxygen fraction, 1.0; tidal volume, 20 ml/kg; respiration rate, 30 breaths/min; and inspiratory:expiratory ratio, 1:2. SVF (2.5% vol) was administered during mechanical ventilation by ventilator (Aestiva/5 7900, as above; group OF and NAOF). For animals in the group NA, exfoliating club cells were created by exposure to naphthalene vapor at a concentration of 100 mg/l for 12 h.

The mean arterial pressure, end tidal CO₂ and SVF concentrations were continuously monitored and maintained within normal ranges. Ringer's solution (10 ml/kg/h) was continuously infused through the right external jugular vein catheter. The rabbits were anesthetized with pentobarbital sodium (30 mg/kg intravenously; Shandong West Asia Chemical Industry Co., Ltd., Shandong, China) during the sham surgeries. Anesthesia was maintained by continuous infusion of remifentanil (cat. no. 1110710; Yichang Humanwell Pharmaceutical Co., Ltd., Yichang, China) at a rate of 1 µg/kg/min and intermittent administration of vecuronium (0.1 mg/kg per 30 min; cat. no. 111004.2; Zhejiang Xianju Pharmaceutical Co., Ltd., Zhejiang, China) during either OLV or TLV.

The right lower lobe was excised and the wet weight was recorded. The lobe was then desiccated at 80°C for 72 h to measure the dry weight. The W/D ratio was calculated.

The right upper lobe were fixed for 6–12 h in 4% paraformaldehyde at 20–24°C, embedded in paraffin wax and then cut into 5 µm sections using a microtome. The sections were stained using a hematoxylin and eosin staining kit (cat. no. G1120; Beijing Solarbio Science & Technology Co., Ltd., Beijing, China) at 20–24°C according to the manufacturer's instructions. In brief, sections were stained in hematoxylin (1 g/l) for 16 min and eosin (1 g/100 ml) for 15 sec. Slides were viewed by a pathology technician using light microscopy for histological evaluation of the lung injury.

Total RNA was extracted from the right middle lobes using a TRIzol RNA Extraction kit (cat. no. 12183555; Thermo Fisher Scientific, Inc., Waltham, MA, USA). The first-strand cDNA was synthesized using Superscript IV Reverse Transcriptase system (cat. no. 18091050; Thermo Fisher Scientific, Inc.), according to the manufacturer's protocol. Briefly, 50 µM Oligo(dT)20 and 10 mM dNTP mix was added into 1.0 µg total RNA and annealed at 65°C for 5 min. Following this, 200 U/µl Superscript IV reverse transcriptase and 100 mM DTT was added in the presence of SSIV buffer, and the RT system was incubated for 10 min at 55°C, followed by 10 min at 80°C. Reverse transcription-quantitative polymerase chain reaction was performed using a BioEasy SYBR Green I Real Time PCR kit (cat. no. 04913850001; Roche Diagnostics GmbH) according to the manufacturer's protocols. The reaction took place at 95°C for 10 min, followed by 40 cycles of 95°C for 15 sec and 60°C for 30 sec. The experiment was replicated three times per sample. The results were quantified using the 2^−ΔΔCq method (20). The forward and reverse sequences for the primers (5′-3′) used in this study were as follows: β-actin, forward CATCCTGACGCTCAAGTA, reverse GTTGTAGAAGGTGTGGTG; CCSP, forward CACCAAAGCCTCCAACCT, reverse GGCAGATGTCCGAAGAAG; c-PLA₂, forward CCTAATCATTGTTGGAAGATAA, reverse ATGGTTGCTTGGAGAATA.

Freshly frozen samples of lung tissues from the rabbits were homogenized in pre-cooled radioimmunoprecipitation assay lysis buffer (cat. no. P0013C; Beyotime Institute of Biotechnology, Haimen, China) supplemented with 15 µl protease inhibitor cocktail (cat. no. 5892970001; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). The protein concentrations were determined by using a bicinchoninic acid kit (cat. no. P0010; Beyotime Institute of Biotechnology). Proteins (80 µg/lane) were separated by 10% SDS-PAGE. The membrane was blocked with 5% bovine serum albumin (cat. no. V900933; Sigma-Aldrich; Merck KGaA) at 20–24°C for 1.5 h. GAPDH was used as the reference gene. For western blotting, the nitrocellulose membranes were incubated overnight at 4°C with primary antibodies against CCSP (2 µg/ml; cat. no. ab50711; Abcam, Cambridge, UK), c-PLA₂ (1 µg/ml; cat. no. ab73406; Abcam) and GAPDH (1:2,000; cat. no. 20011; Abmart, Inc., Shanghai, China), followed by incubation with the secondary antibody (cat. no. M21003; Abmart) at room temperature for 2 h. The blots were detected by enhanced chemiluminescence (Bio-Rad Laboratories, Inc., Hercules, CA, USA), and the band intensities were quantified using ImageJ software 1.44 (National Institutes of Health, Bethesda, MA, USA).

The content of AA in lung tissues was measured using a commercially available sandwich ELISA kit (cat. no. CSB-EQ027590RB; Wuhan Huamei Biotech Co., Ltd., Wuhan, China) according to the manufacturer's protocols.

The quantitative data are presented as the mean ± standard error of the mean. One-way analysis of variance (with repeated measures) followed by Fisher's least significant difference post hoc test was used as indicated for comparisons between the groups. SPSS v18.0 (SPSS, Inc., Chicago, IL, USA) was used to perform the statistical analysis. P<0.05 was considered to indicate a statistically significant difference.

In the group O, c-PLA₂ expression was significantly increased compared with the sham group (Fig. 1A), whereas CCSP expression was decreased following OLV (P<0.05 vs. group S; Fig. 1B). Following OLV, SVF inhalation (group OF) significantly reduced c-PLA₂ expression (Fig. 1A), and CCSP expression increased (vs. group O; Fig. 1B).

The effects of SVF on the expressional changes of CCSP, an endogenous inhibitor of PLA₂, was further analyzed using the club cell-exfoliated model exposed to naphthalene vapor at a concentration of 100 mg/l for 12 h (groups NA, NAO and NAOF). Low expression levels of CCSP were detected at the mRNA and protein level in groups NA, NAO and NAOF, indicating that club cells were successfully exfoliated (Figs. 1B and 2). As the endogenous inhibitor of c-PLA₂ was not present, the expression of c-PLA₂ was the highest in group NAO. However, following SVF inhalation in the group NAOF, the expression of c-PLA₂ was significantly reduced compared with group NAO (P<0.05; Fig. 1A). A similar pattern of c-PLA₂ and CCSP protein expression was observed in the lungs of the three groups of rabbits (Fig. 2).

Pulmonary AA was determined using an ELISA kit (Fig. 3A). No significant difference in AA content was observed between group S and group NA. The concentrations of AA were significantly increased in all groups following OLV, compared with group S and NA. As expected, the AA contents was reduced following SVF inhalation in the groups OF, NA and NAOF, compared with the groups O and NAO (Fig. 3A). The W/D ratio was used as an indicator of edema formation following OLV. The data revealed that the W/D ratio did not differ significantly between groups S and NA. The W/D ratio increased by 13.3% in group O compared with that in group S. SVF inhalation reduced the W/D ratio in group OF compared with in group O (Fig. 3B). The highest W/D ratio was observed in the group NAO, while SVF inhalation reduced the W/D ratio in the group NAOF compared with group NAO. The histological lung injury scores of different groups are presented in Fig. 3C. OLV increased lung injury scores by 8 times in the O group compared with S group, and 10 times in the NAO group compared with NA group. Following SVF inhalation, the histological lung injury scores were significantly reduced in groups OF and NAOF, compared with in groups O and NAO, respectively.

On examining hematoxylin and eosin-stained lung tissue sections, no significant pathological changes were observed in the sham-operated group (group S) and club cells exfoliated + sham-operated group (group NA; Fig. 4). OLV caused severe lesions in the group O, manifesting as lung hyperemia and hemorrhage, alveolar wall thickening and increased exudation, with significant infiltration of red blood and inflammatory cells in the alveolar spaces. The pathological changes in the group NAO were more extensive compared with those in the group O. In groups OF and NAOF, those in the pathological lesions of lung tissues were significantly alleviated compared with group O and NAO, respectively. However, the pathological lesions in group NAOF were more pronounced compared with those in group OF.