Ethics statement
Written informed consent was obtained from all participants, and the study protocol was approved by the ethics committee of JiangSu Cancer Hospital (Nanjing, China).
Clinical samples and cell lines
ESCC and paired normal esophageal tissues (>5 cm away from the tumor margin) were obtained from 35 patients (median age 63.7 years, range 48–76 years, female:male=1:6) who underwent esophagus resection between September 2016 and June 2017 at JiangSu Cancer Hospital. All patients had no history of previous malignancies, chemotherapy and radiotherapy. All the samples were immediately snap-frozen in liquid nitrogen and stored at −80°C for RNA extraction. All tumors and paired normal tissues were histologically confirmed by two pathologists. Human ESCC cell lines (Te-1 and Kyse-150) were obtained from Chinese Academy of Science cell bank (Shanghai, China), Human Healthy Esophageal Epithelial cell line (HECC) were obtained from iCell Bioscience Inc (Shanghai, China). Cells were cultured and maintained in RPMI 1640 (HyClone; GE Healthcare, Chicago, IL, USA) supplemented with 10% fetal bovine serum (FBS, Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) in an incubator with 5% CO2 at 37°C. All culture materials were purchased from Gibco; Thermo Fisher Scientific, Inc.
Mir-675-3p overexpression and interference oligonucleotide transfection assay
Kyse-150 and Te-1 cells were seeded at a density of 5×104 cells/ml in six-well plates and incubated overnight at 37°C. According to the protocol, they were transiently transfected with the 20 µmol interference oligonucleotide which included negative control (NC; 5′-3′ CAGUACUUUUGUGUAGUACAA), mir-675-3p inhibitor (5′-3′ UGAGCGGUGAGGGCAAUACAG) or mir-675-3p mimic (sense 5′-3′ CUGUAUGCCCUCACCGCUCA; anti-sense 5′-3′ AGCGGUGAGGGCAUACAGUU) using Lipofectamine® 2000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.). Following 6 h transfection at 37°C, the medium was replaced with RPMI1640 media containing 10% FBS. Three group were used in this experiment, which included negative control (NC), miR-675-3p inhibitor group and miR-675-3p inhibitor + miR-675-3p mimic. The group of NC and miR-675-3p inhibitor were only transfected with NC or miR-675-3p inhibitor, respectively, and the group of miR-675-3p inhibitor + miR-675-3p mimic, were transfected with miR-675-3p mimics 6 h following transfection with miR-675-3p inhibitor.
Total RNA extraction and reverse transcription-quantitative polymerase chain reaction (RT-qPCR)
At 24 h post-transfection, cells were treated with TRIzol (Takara Bio, Inc., Otsu, Japan) to extract total RNA, which was reverse transcribed to first strand cDNA using Primescript RT Reagent (Takara Bio, Inc.). The expression levels of miR-675-3p (sense 5′-CGGAGAGGGCCCACAGTG-3′; anti-sense was an universal primer which was obtained from GeneCopoeia, USA), MMP2 (sense 5′-GCTGACGGTAAGGACGGACTC-3′; anti-sense 5′-CGTTGCCATTGAACAAGAAGG-3′), MMP9 (sense 5′-TGTGCTACAGGGAGAGATAAGA-3′; anti-sense 5′-GTGGGTGGAGCAGAGTAAATAA-3′) and E-cadherin (sense 5′-CTCAGTTGGAACAGGGTGAATA-3′; anti-sense 5′-GTGCAGGACACTCAAATCAAAG-3′) were examined using RT-qPCR in a Step one plus system (Roche Molecular Diagnostics, Pleasanton, CA, USA) using 2−ΔΔCq analysis. In this system, all reactions were performed in SybrGreen (ChamQ™ SYBR qPCR Master Mix; Vazyme, Piscataway, NJ, USA), in a volume of 20 ul containing 2 ul cDNA, according to the manufacturer's protocol. All reactions were performed in triplicate. The thermal cycling conditions included a step of 5 min at 95°C followed by 40 cycles of 95°C for 10 sec and 60°C for 30 sec. U6 was used as internal control. Final amounts of target in cells were determined as follows: Target amount=2−ΔΔCq, where ΔΔCq=[Cq (target)-Cq (U6)]sample-[Cq (target)-Cq (U6)]internal standard. Final amounts of target in tissues were determined as target amount=2−ΔΔCq (14).
Cell proliferation assay
Cell proliferation was monitored by a colorimetric assay using the Cell Counting Kit-8 (CCK-8, Vazyme) according to the manufacturer's protocol. Briefly, cells were seeded on 6-well plates and transfected with NC, miR-675-3p inhibitor or miR-675-3p inhibitor + miR-675-3p mimics, after 12 h of transfection, the cells were transferred onto the 96-well plates (8×103 cells/well) and the cell proliferation assays were conducted and analyzed by a Microplate Reader (ELx808; BIO-TEK Instruments, Inc., Winooski, VT, USA) every 12 h for 3 days using CCK-8.
Scratch wound assay
Cells (3×105) were transfected with NC, miR-675-3p inhibitor or miR-675-3p inhibitor + miR-675-3p mimics and cultured in a cell culture dish (35×10 mm). Cell layers were scratched using a pipette tip to form wound gaps. The wound location in the cell culture dish was marked. Cells were imaged to record the wound width (0 h). A total of 12 h following this, images were taken again at the marked wound location to measure the cell migration ability.
Transwell invasion and migration ability assay
Cells (3×105) were transfected with NC, miR-675-3p inhibitor or miR-675-3p inhibitor + miR-675-3p mimics according to the protocol. Following incubation for 12 h, Kyse-150 cells or Te-1 cells were transferred to the upper Matrigel-coated or not Matrigel-coated invasion chambers (BD Biosciences, San Jose, CA, USA) in a serum-free RPMI 1640, and RPMI 1640 containing 10% FBS was added to the lower chambers. Following 24 h, non-migrated or non-invaded cells on the upper surface were removed, and the migrating or invading cells on the underside surface were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet at room temperature for 15 min, and imaged. A total of three independent experiments were performed.
ELISA
Kyse-150 cells (3×105) or Te-1 cells (3×105) were cultured in six-well plates and following 24 h transfection with NC, miR-675-3p inhibitor or miR-675-3p inhibitor + miR-675-3p mimics, the related proteins in the cell culture were extracted by centrifuging at 300 × g for 10 min at 4°C following the manufacturer's protocol. The protein concentrations of matrix metalloproteinase (MMP)2, MMP9 and E-cadherin were measured by ELISA assay (Hangzhou Multisciences, Biotech Co., Ltd, Zhejiang, China, catalog number: EK1M022-96T, EK1M092-96T, EK12352-96T, respectively) following the manufacturer's protocol. All samples were measured in duplicate.
Western blot analysis
Protein levels of MMP2, MMP9 and E-cadherin were detected by western blotting 24 h following treatment. In brief, the total cell proteins were extracted from cells using lysis buffer (Cell Signaling Technology Inc., Danvers, MA, USA). BCA assay (Thermo Fisher Scientific, Inc.) was carried out to measure the protein concentrations. Equal amounts of protein samples (25 µg) were separated by 12% SDS-PAGE and then transferred onto polyvinylidene difluoride membranes. Following this, the membranes were blocked with 5% skim milk at room temperature for 2 h. Subsequently, incubation occurred with the primary antibodies against MMP2 (cat. no. 13132), MMP9 (cat. no. 2270) or E-cadherin (cat. no. 3195; all 1:1,000; all Cell Signaling Technology Inc.) overnight at 4°C. The membrane was then incubated with secondary antibodies (HRP-conjugated goat Anti-Rabbit, cat. no. Ab203-01, Vazyme, Piscataway, NJ, USA) at room temperature for 2 h. GAPDH (1:5,000; cat. no. 8884, Cell Signaling Technology Inc.) served as the internal control. Finally, to visualize the protein bands, an enhanced chemiluminescence detection system (Super Signal West Dura Extended Duration Substrate; Thermo Fisher Scientific, Inc.) was used.
Statistical analysis
Data were analyzed by GraphPad Prism5 (GraphPad Software, Inc., La Jolla, CA, USA) and were expressed as the mean ± standard deviation. Comparisons between groups were made using Student's t-test or one-way analysis of variance followed by Tukey's test. P<0.05 was considered to indicate a statistically significant difference.