Podocytes (MPC-5 cells) were acquired from the Bena Culture Collection (Beijing, China). Podocytes were cultured in Ham Nutrient Mix F12-Dulbecco modified Eagle medium (Thermo Fisher Scientific, Inc., Waltham, MA, USA) with 1% penicillin-streptomycin G (Biochrom, Ltd., Cambridge, UK) and 10% fetal bovine serum (Gibco; Thermo Fisher Scientific, Inc.). Podocytes were seeded in 6-well plates at a concentration of 3×10⁵ cells/ml and subsequently treated with PBS (control), or with PAN (0, 5, 10, 20, 40, 60, 80 and 100 µg/ml) for 0, 6, 12, 24 and 48 h time intervals at 37°C.

Mouse KLF5 complementary (c)DNA clone was purchased from GeneCopoeia Inc. (Rockville, MD, USA). KLF5 was amplified with PrimSTAR DNA polymerase (Takara Bio, Inc., Otsu, Japan) using primers with methylation-sensitive EcoRI and XhoI restriction sites. The PCR thermocycling was set as: 95°C, 3 min; 30 cycles of 95°C, 30 sec; 58°C, 30 sec; 72°C, 90 sec; 72°C, 10 min. The primer sequences of KLF5 were as follows: Forward, 5′ATGCCCACGCGGGTGCTGACC3′ and reverse, 5′ATGAAGCGCCACCAGAACTGA3′. PCR products were then digested with EcoRI and XhoI restriction endonucleases and subsequently inserted into the pcDNA 3.1 vector (Invitrogen; Thermo Fisher Scientific, Inc.).

Treated podocytes (2×10³ cells/well) were seeded into a 96-well plate. The cells were treated with PAN at different concentrations (0, 5, 10, 20, 40, 60, 80 and 100 µg/ml) and maintained at 37°C for 0, 6, 12, 24 and 48 h time intervals. Following this, 20 µl of MTT solution was added into each well and incubated for 30 min. A total of 150 µl dimethylsulfoxide was subsequently was added into each well. Finally, a microplate reader was used to determine the absorbance at 490 nm. Treatment with 60 µg/ml PAN for 6 h was selected for subsequent analysis as this resulted in decreased cell viability (described below).

Podocytes were plated in 6-well plates at a density of 1×10⁶ cells per well. Cells were treated with PBS or 60 µg/ml PAN for 6 h at 37°C. KLF5 overexpression (1 ug) or negative control plasmids (pcDNA 3.1; 1 µg) were transfected into podocytes using Lipofectamine^® 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's instructions. After 12 h following transfection, the cells were used for subsequent experimentation.

Total RNA was obtained using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.). RNA was reversely transcribed to cDNA using a miScript II RT Kit (Qiagen GmbH, Hilden, Germany). The temperature protocol or RT was 25°C for 5 min, 37°C for 60 min, 85°C for 5 min and then held at 4°C. The mRNA expression levels were subsequently determined using the SYBR-Green PCR Master Mix kit (Takara Bio, Inc.) and the ABI 7500 system (Applied Biosystems; Thermo Fisher Scientific, Inc.). The thermocycling conditions were set as: 5 min pretreatment at 95°C, followed by 28 cycles of 95°C for 15 sec and 60°C for 30 sec, a final extension at 72°C for 10 min. The specific primers used were as follows: KLF5 forward, 5′-TTTCTGTCCCTACCCAGCAG-3′ and reverse, 5′-AGTAAGTGGCCTGTTGTGGA-3′; Bax forward, 5′-GAGCTGCAGAGGATGATTGC-3′ and reverse, 5′-CCAATGTCCAGCCCATGATG-3′; Bcl-2 forward, 5′-GCCTTCTTTGAGTTCGGTGG-3′ and reverse, 5′-GAAATCAAACAGAGGCCGCA-3′; Caspase-3 forward, 5′-TTGCCACCTGTCCAGTTTTG-3′ and reverse, 5′-AGGAGTGAGTGGTCTTGCTC-3′; caspase-8 forward, 5′-TTTCTGTCCCTACCCAGCAG-3′ and reverse, 5′-AGTAAGTGGCCTGTTGTGGA-3′; Caspase-9 forward, 5′-GCCCCATATGATCGAGGACA-3′ and reverse, 5′-CAGAAACGAAGCCAGCATGT-3′; cyclin D1 forward, 5′-GCTGCTCCTGGTGAACAAGC-3′ and reverse, 5′-TTGCGTCTCAGCTCAGGGAC-3′; and c-myc forward, 5′-CCACAGCAAACCTCCTCACA-3′ and reverse, 5′-TCCAACTTGACCCTCTTGGC-3′. GAPDH forward, 5′-GGGTCCCAGCTTAGGTTCAT-3′; GAPDH reverse, 5′-CATTCTCGGCCTTGACTGTG-3′. Data were quantified using the 2^−ΔΔCq method (25).

Total proteins were prepared using a radioimmunoprecipitation assay buffer (Beyotime Institute of Biotechnology, Shanghai, China) containing a protease inhibitor cocktail (P8340; Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Protein concentrations were determined using a Bradford Protein Assay kit (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Proteins (30 µg) were separated via 10% SDS-PAGE gels and then transferred onto polyvinyl difluoride (PVDF) membranes (PerkinElmer, Inc., Waltham, MA, USA). Following this, the membranes were blocked with 5% skimmed milk (BD Biosciences, Franklin Lakes, NJ, USA) at room temperature for 2 h. The membranes were subsequently incubated with the following primary antibodies overnight at 4°C: Anti-GAPDH (1:2,000; cat. no. ab8245; Abcam, Cambridge, UK), anti-KLF5 (1:1,000; cat. no. ab24331; Abcam), anti-B cell lymphoma 2 (Bcl-2) associated X (Bax; 1:1,000; cat. no. ab32503; Abcam), Bcl-2 (1:1,000; cat. no. ab32124; Abcam), anti-caspase-3 (1:1,500; cat. no. ab13586; Abcam), anti-caspase-8 (1:1,500; cat. no. ab25901; Abcam), anti-caspase-9 (1:1,500; cat. no. ab25758; Abcam), anti-cyclin D1 (1:1,000; cat. no. ab134175; Abcam), anti-c-myc (1:1,000; cat. no. ab39688; Abcam), anti-phosphorylated (p)-extracellular signal-regulated protein kinase (ERK)1/2 (1:1,200; cat. no. 4370; Cell Signaling Technology, Inc., Danvers, MA, USA), anti-ERK1/2 (1:1,000; cat. no. ab184699; Abcam), anti-p-p38 (1:1,000; cat. no. ab47363; Abcam), anti-p38 (1:1,000; cat. no. ab170099; Abcam). PVDF membranes were subsequently incubated with a horseradish peroxidase-conjugated secondary antibody (1:5,000; cat. no. sc-2004, Santa Cruz Biotechnology, Inc., Dallas, TX, USA) at room temperature for 1 h. Finally, the proteins were visualized using ECL Western Blotting Substrate (Pierce; Thermo Fisher Scientific, Inc.) in an enhanced chemiluminescence detection system (GE Healthcare, Chicago, IL, USA). The gray value was determined by Quantity One 4.6.2 software (Bio-Rad Laboratories, Inc.).

Podocytes were fixed with 4% paraformaldehyde at 4°C for 20 min, and then permeabilized with 0.2% Triton X-100 for 3 min. Following this, cells were washed with PBS and then blocked using 10% goat serum (Thermo Fisher Scientific, Inc.) for 30 min at room temperature. Cells were subsequently incubated with 4 µg/ml anti-synaptopodin antibodies (cat. no. ab220345; Abcam) overnight at 4°C. Following this, cells were washed using PBS and then incubated with Alexa-Fluor^® 633-conjugated secondary antibodies (1:500; A-21070, Thermo Fisher Scientific, Inc.) at 37°C for 1 h. Cells were subsequently stained using 4′-6-diamidino-2-phenylindole (Thermo Fisher Scientific, Inc.) for 5 min at room temperature. A fluorescence microscope (magnification, ×200; Olympus Corporation, Tokyo, Japan) was used to visualize the results.

Podocytes were treated as described above. Cells (2×10⁵ cells/well) were seeded into 24-well plates and incubated overnight at 37°C. To investigate the cell cycle, cells were centrifuged at 1,000 × g for 5 min at 4°C and subsequently fixed using 70% (v/v) ethanol for 1 h at 4°C. Following this, cells were washed with PBS and then incubated with 500 µl propidium iodide (PI)/RNase buffer (BD Biosciences, Franklin Lakes, NJ, USA) at room temperature for 30 min. Finally, a FACS-Calibur flow cytometer (BD Biosciences) was used to investigate cell cycle distribution, and ModFit LT 2.0 software (Verity Software House, Inc., Topsham, ME, USA) was used to analyze the results. To investigate apoptosis, cells were washed with PBS and then re-suspended with 0.5 ml binding buffer containing 5 µl Annexin V-fluorescein isothiocyanate and PI double stain (BD Biosciences) for 20 min at room temperature in the dark. Following this, the apoptotic rate was determined using a FACS-Calibur flow cytometer (BD Biosciences) and ModFit LT 2.0 software.

All data were analyzed by SPSS 13.0 (SPSS, Inc., Chicago, IL, USA) using one-way analysis of variance with Tukey's test. Data are presented as the mean ± standard deviation. All experiments were performed in triplicate. P<0.05 was considered to indicate a statistically significant difference.

Initially, synaptopodin expression in podocytes was investigated using immunofluorescence. The results revealed that the expression of synaptopodin was positive in podocytes (Fig. 1A). To further investigate the effect of PAN on the proliferation ability of podocytes, podocytes were treated with PBS (control) or PAN (5, 10, 20, 40, 60, 80, and 100 µg/ml) for 0, 6, 12, 24 and 48 h time intervals. The results revealed that the viability of podocytes were markedly inhibited following treatment with PAN in a dose- and time-dependent manner (Fig. 1B; P<0.05). It was observed that the cell viability significantly decreased when the cells were treated with 60 µg/ml PAN for 6 h. Therefore, the present study selected 60 µg/ml PAN to treat the cells for 6 h.

To further investigate the potential role of KLF5 in podocytes, KLF5 was overexpressed in podocytes via transfection with pCDNA3.1-KLF5 plasmids. RT-qPCR and western blot assays were performed to determine the expression levels of KLF5. The results demonstrated that KLF5 expression was significantly increased in podocytes transfected with pCDNA3.1-KLF5 compared with the NC group (Fig. 2; P<0.001), which suggested that transfection to establish the podocyte injury model was successful.

The results revealed that the proportion of cells in the G1 phase was increased in the PAN group compared with the control group (Fig. 3A). The number of cells in the G1 phase was decreased in the KLF5+PAN group compared with the NC+PAN group (Fig. 3A, P<0.05). In addition, the results demonstrated that treatment with PAN promoted cell cycle arrest in podocytes (P<0.05); however, this effect was markedly attenuated following overexpression of KLF5 (Fig. 3A, P<0.05). In addition, the expression levels of cyclin D1 and c-myc were investigated via RT-qPCR and western blot assays, and the results revealed that cells treated with PAN exhibited significantly decreased expression levels of cyclin D1 and c-myc compared with the NC group (P<0.01), whereas cells overexpressing KLF5 exhibited significantly increased expression levels of cyclin D1 and c-myc compared with the NC + PAN group (Fig. 3B-D, P<0.05).

Flow cytometry was performed to determine whether KLF5 has an important role in the apoptosis of podocytes. The results demonstrated that the apoptosis of podocytes was significantly increased in the PAN group compared with the NC group (P<0.001; Fig. 4A); however, this effect was significantly attenuated following overexpression of KLF5 (P<0.05; Fig. 4A). Furthermore, the expression levels of genes associated with apoptosis (Bax, Bcl-2, caspase-3, caspase-8 and caspase-9) were investigated using RT-qPCR and western blot assays. The results revealed that treatment with PAN significantly enhanced the expression levels of Bax, caspase-3, caspase-8 and caspase-9 exhibited by podocytes (P<0.01 and P<0.001; Fig. 4B and C); however, overexpression of KLF5 significantly attenuated this effect (P<0.05 and P<0.01; Fig. 4B and C). In addition, podocytes treated with PAN exhibited significantly decreased Bcl-2 expression, and overexpression of KLF5 significantly attenuated this effect (P<0.05, P<0.01 and P<0.001; Fig. 4B and C).

MAP kinases have important roles in numerous cellular functions and are regulated via independent upstream activation cascades (26). In the present study, the effects of KLF5 and PAN on the ERK/p38 MAP kinase pathway in podocytes were investigated. The protein levels of p-ERK1/2, ERK1/2, p-p38 and p38 in podocytes were investigated using a western blot assay. The results revealed that treatment with PAN significantly enhanced ERK1/2 and p38 phosphorylation compared with the control group; however, overexpression of KLF5 significantly attenuated these effects (P<0.001; Fig. 5).