In order to establish a TNF-α-induced insulin resistance model, 16-week-old male C57BL/6J mice (n=5; 30 g, Beijing HFK Bioscience Co., Ltd., Beijing, China) were fed with a standard laboratory diet and injected with 15 µg/ml TNF-α via Alzet osmotic pumps (DURECT Corporation, Cupertino, CA, USA) for 2 weeks continuously at an infusion rate of 0.5 µl/h. For the control group, 16-week-old male C57BL/6J mice (n=5) were injected with 0.9% NaCl via Alzet osmotic pumps for 2 weeks at the aforementioned infusion rate. Following fasting for 8 h, mice were subsequently anaesthetized via intrapertioneal injection with sodium pentobarbital (40 mg/kg body weight), and liver samples were then collected. All mice were housed in an experimental animal facility of Beijing Normal University (Beijing, China) at a temperature of 20–24°C and humidity-controlled (45–55%) environment. A 12 h light/dark cycle was maintained in the animal housing rooms. The food and water were supplied for all days. All animal experiments performed in the present study were approved by the Animal Use and Care Committee of Beijing Normal University and were performed in accordance with the Guide for Care and Use of Laboratory Animals (14).

For animal experiments, 6 mice were used in each group. To investigate the effect of miR-338-3p on TNF-α-induced gluconeogenesis, after 7 days following the implantation of the TNF-α pumps, 6 C57BL/6J mice were injected with adenoviral vectors expressing miR-338-3p mimics (Ad-338m) (2×10⁹ plaque-forming unit/25 g body weight). A total of 6 C57BL/6J mice were injected with adenoviral vectors expressing negative control microRNA (Ad-NC) (2×10⁹ plaque-forming unit/25 g body weight). In addition, adenoviral vectors expressing miR-338-3p inhibitors (Ad-338i) or negative control inhibitors (Ad-NCI) were injected into 6 C57BL/6J mice (2×10⁹ plaque-forming unit/25 g body weight). All the adenoviral vectors, including Ad-338m, Ad-NC, Ad-338i and Ad-NCI were purchased from Shanghai GeneChem Co., Ltd. (Shanghai, China). After 7 days following injection, mice were used for following experiments. The sequences employed in the present study were as follows (5′-3′): miR-338-3p mimic, UCCAGCAUCAGUGAUUUUGU and negative control mimics, UUCUCCGAACGUGUCACGUTT; miR-338-3p inhibitor, CAACAAAAUCACUGAUGCUGGA and negative control inhibitors, CAGUACUUUUGUGUAGUACAA.

After 7 days following injection, pyruvate tolerance analysis was performed. Following fasting for 14 h, mice were intraperitoneally injected with pyruvate (2 g/kg of body weight) in order to perform pyruvate tolerance testing. Blood glucose levels were measured using an ACCU-CHEK Advantage glucometer (Roche Diagnostics GmbH, Mannheim, Germany) at specific time intervals.

HEPA1-6 murine liver cells (American Type Culture Collection, Manassas, VA, USA) were cultured in low-glucose Dulbecco's modified Eagle's medium (DMEM; Invitrogen; Thermo Fisher Scientific, Inc., Waltham, MA, USA) supplemented with 10% fetal serum (HyClone; GE Healthcare Life Sciences, Logan, UT, USA), 100 units/ml penicillin (Invitrogen; Thermo Fisher Scientific, Inc.) and 0.1 mg/ml streptomycin (Hyclone; GE Healthcare Life Sciences) at 37°C with humidified air and 5% CO₂. In order to determine the effect of TNF-α on gluconeogenesis, the HEPA1-6 cells were treated with 10 ng/ml TNF-α for 24 h at 37°C with humidified air and 5% CO₂.

miR-338-3p mimic and inhibitor sequences used for transfection were as follows (5′-3′): miR-338-3p mimic sense, UCCAGCAUCAGUGAUUUUGUUG and antisense, ACAAAAUCACUGAUGCUGGAUU; NC sense, UUCUCCGAACGUGUCACGUTT and antisense, ACGUGACACGUUCGGAGAATT; miR-338-3p inhibitor, CAACAAAAUCACUGAUGCUGGA; NCI, CAGUACUUUUGUGUAGUACAA. All miR oligos were purchased from Genepharm, Inc. (Sunnyvale, CA, USA). A day before transfection, 3.6×10⁵ cells were seeded in each well of 6-well plate in 1.6 ml DMEM medium. miR-338-3p mimic and inhibitor (3.75 µl, 20 µM) were transfected into HEPA1-6 by using HiPerFect transfection reagent (Qiagen, Inc., Valencia, CA, USA). Subsequent experimentation was performed 48 h following transfection.

The sequences of PP4R1-specific small interfering (siRNAs) used for transfection were as follows (5′-3′): PP4R1 sense, GAACCAACTGTGAGAGCGGA; and antisense, TGGGGCAGTCAGGTCTATGA. All siRNA oligos were purchased from Genepharm, Inc. A day before transfection, 3.6×10⁵ cells were planted in each well of 6-well plate in 1.6 ml DMEM. PP4R1-specific siRNAs (3.75 µl, 20 µM) were transfected into HEPA1-6 cells using HiPerFect transfection reagent (Qiagen, Inc.). Subsequent assays were performed 48 h following transfection.

Total RNA of HEPA1-6 cells and mouse liver cells was extracted using TRIzol (Invitrogen; Thermo Fisher Scientific, Inc.). A total of 1 µg RNA was reverse transcribed into cDNA using the EasyScript First-strand cDNA Synthesis kit (Beijing Transgen Biotech Co., Ltd., Beijing, China). The procedures of RT were described as follow: 70°C for 10 min, 42°C for 60 min, 95°C for 5 min and 4°C hold. Expression levels of PGC-1α, PEPCK and G6Pase were determined via qPCR using the SYBR Green II kit (Takara Biotechnology Co., Ltd., Dalian, China) in accordance with the manufacturer's protocol. cDNA (1 µg), 10 µl SYBR-Green mixture, 0.8 µl primers (10 µm) and 8.2 µl ddH₂O were mixed. The procedures of qPCR were as follows: 95°C for 30 sec, followed by 40 cycles at 95°C for 5 sec and 60°C for 20 sec. The sequences of primers used for PCR were as follows (5′-3′): G6Pase forward, TCTGTCCCGGATCTACCTTG and reverse, GTAGAATCCAAGCGCGAAA; PEPCK forward, TCTGAGATCTCTGATCCAGACC and reverse, GAAGTCCAGACCGTTATGCAGC; PGC-1α forward, GCCTATGAGCACGAAAGGC and reverse, TCACACGGCGCTCTTCAATT; 18s forward, GGAAGGGCACCACCAGGAGT and reverse, TGCAGCCCCGGACATCTAAG. The gene expression level was calculated using 2^−ΔΔCq method (15).

Total protein from liver and cells was extracted with radioimmunoprecipitation (Beijing Solarbio Science & Technology Co., Ltd., Beijing, China). And the concentration of protein sample was measure by BCA kit (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany). Cell protein samples (15 µg) were separated via 10% SDS-PAGE, transferred to polyvinylidene fluoride membranes (EMD Millipore, Billerica, MA, USA) and then blocked using 8% non-fat dry milk for 2 h at room temperature. Following this, the membranes incubated with 1:1,000 diluted primary antibodies for 12 h at 4°C. The blots were then incubated with 1:5,000 diluted horseradish peroxidase-conjugated anti-IgG (cat. no. 7074; Cell Signaling Technology, Inc. Danvers, MA, USA) for 2 h at room temperature. Proteins were then visualized using an enhanced chemiluminescent kit (EMD Millipore). Antibodies against FOXO1 (cat. no. 2880), phosphorylated FOXO1 (cat. no. 9461), PEPCK (cat. no. 6924) and GAPDH (cat. no. 5174) were purchased from Cell Signaling Technology, Inc. Antibodies against PGC-1α (ab54481) and G6Pase (ab83690) were purchased from Abcam (Cambridge, UK).

TargetScan (http://www.targetscan.org/), Pictar (http://www.pictar.org/) and miRanda (http://microrna.org/) databases were used to predict that PP4R1 was a target of miR-338-3p. The miR-338-3p binding site with in the PP4R1 3′-UTR was verified and in previously study (13). The PP4R1 3′-UTR fragment, including the miR-338-3p binding site was cloned from mouse liver cells and inserted into pmirGLO vector (Promega Corporation, Madison, WI, USA). A day prior to transfection, HEPA1-6 cells were seeded at 3.6×10⁵ cells per well of 6-well plate in 1.6 ml DMEM. pmirGLO-3′UTR PP4R1 with miR-338-3p mimic or inhibitor (3.75 µl, 20 µM) were transfected into HEPA1-6 by using HiPerFect transfection reagent. The subsequent assays were performed after 48 h post-transfection. Luciferase activity was analyzed by using the Dual-Glo Luciferase assay system (Promega Corporation). Luciferase activity was normalized to Renilla luciferase activity. All the assays were repeat for 4 times.

After 24 h of TNF-α treatment, a glucose production assay was performed. Cells were washed five times with PBS and then stimulated with 10 ng/ml TNF-α, 2 mmol/l sodium pyruvate and 20 mmol/l sodium lactate in glucose- and serum-free DMEM medium for 18 h. The glucose concentration in the medium was subsequently determined using a glucose assay kit (Sigma-Aldrich; Merck KGaA, Darmstadt, Germany) and subsequently normalized to the previously determined total protein content via a BCA kit (Sigma-Aldrich; Merck KGaA) in whole cell extracts.

All data are presented as the mean ± standard error of the mean. The two-tailed unpaired Student's t-test was used for comparisons between two groups. In addition, One-way analysis of variance followed by Tukey's post hoc test was used for comparisons between more than two groups. Statistical analyses were performed using SPSS 3.0 software (SPSS, Inc., Chicago, IL, USA). P<0.05 was considered to indicate a statistically significant difference. All the experiments were repeated for four times.

In our previous study, it was demonstrated that treatment with TNF-α decreased miR-338-3p expression levels and suppressed the activation of the AKT/GSK pathway in the livers of mice (13). In the present study, treatment with TNF-α significantly decreased the level of p-FOXO1/FOXO1 and significantly increased the protein and mRNA expression levels of genes associated with gluconeogenesis in the livers of mice, including PGC-1α, G6Pase and PEPCK (Fig. 1A and B). Consistently, treatment of 10 ng/ml TNF-α enhanced glucose production in HEPA1-6 cells (Fig. 1C). Furthermore, in HEPA1-6 cells following treatment with 10 ng/ml TNF-α for 24 h, the levels of p-FOXO1/FOXO1 were reduced, and the protein and mRNA expression of PGC-1α, G6Pase and PEPCK were increased (Fig. 1D and E).

To determine the importance of miR-338-3p in the regultion of gluconeogenesis, an adenovirus expressing miR-338-3p mimic was injected into TNF-α-treated mice via the tail vein for 7 days. The results revealed that levels of p-FOXO1/FOXO1 were significantly increased, whereas mRNA and protein expression levels of PGC-1α, G6Pase and PEPCK were significantly decreased, in the livers of mice injected with Ad-338m compared with the control group accompanied by ameliorated pyruvate tolerance (Fig. 2A-C). In HEPA1-6 cells, transfection with miR-338-3p mimics was demonstrated to significantly attenuate TNF-α-induced glucose production (Fig. 2D). In addition, upregulation of miR-338-3p was revealed to significantly enhanced levels of p-FOXO1/FOXO1, and significantly decreased the expression levels of PGC-1α, G6Pase and PEPCK, compared with the NC group (Fig. 2E and F). In conclusion, these results suggested that miR-338-3p may have an important role in TNF-α-induced gluconeogenesis.

The effect of treatment with miR-338-3p inhibitors on glucose production in hepatocytes was investigated in the present study. An adenovirus expressing miR-338-3p inhibitor (Ad-338i) was injected into mice via the tail vein over 7 days. Inhibition of miR-338-3p decreased the levels of p-FOXO1/FOXO1 in livers of mice; the protein and mRNA expression levels of PGC-1α, G6Pase and PEPCK were increased in the liver, and pyruvate tolerance was impaired in mice injected with Ad-338i (Fig. 3A-C). Furthermore, HEPA1-6 hepatocytes transfected with a miR-338-3p inhibitor exhibited significantly reduced levels of p-FOXO1, increased levels of glucose production, and increased mRNA and protein expression of PGC-1α, G6Pase and PEPCK, compared with the NC group (Fig. 3D-F). These results suggested that miR-338-3p may regulate glucose production via the AKT/FOXO1 pathway.

In our previous study, PP4R1 was revealed to represent a target gene of miR-338-3p. The 3′-UTR of PP4R1 was cloned and luciferase reporter vectors were subsequently constructed (13). The relative luciferase activity was significantly decreased following transfection with miR-338-3p mimics (Fig. 4A); however, relative luciferase activity was not markedly affected following transfection with miR-338-3p inhibitors (Fig. 4B). To verify whether miR-338-3p regulates glucose production via targeting of PP4R1, miR-338-3p inhibitors and PP4R1 siRNA were co-transfected into HEPA1-6 cells. The results revealed that downregulation of PP4R1 significantly attenuated miR-338-3p-induced increased levels of glucose production (Fig. 4C), and expression levels of genes associated with gluconeogenesis. However, transfection of PP4R1 siRNA reversed the effect of miR-338-3p inhibitor on the level of p-FOXO1/FOXO1 (Fig. 4D and E).

Furthermore, in order to determine whether PP4R1 is involved in the regulation of glucose production by TNF-α, PP4R1 siRNA was transfected into HEPA1-6 cells for 48 h, which was followed by treatment with TNF-α for 24 h. The results demonstrated that downregulation of PP4R1 significantly attenuated increased levels of glucose production following treatment with TNF-α (Fig. 4F), as well as PGC-1α, G6Pase and PEPCK mRNA and protein expression levels However, transfection of PP4R1 siRNA reversed the effect of TNF-α on the level of p-FOXO1/FOXO1 (Fig 4G and H). In conclusion, these results suggested that miR-338-3p is involved in TNF-α-mediated glucose production via targeting of PP4R1.